Open Access

Differential gene expression profiling of endometrium during the mid-luteal phase of the estrous cycle between a repeat breeder (RB) and non-RB cows

  • Ken-Go Hayashi1,
  • Misa Hosoe2,
  • Keiichiro Kizaki3,
  • Shiori Fujii1,
  • Hiroko Kanahara1,
  • Toru Takahashi3 and
  • Ryosuke Sakumoto1Email author
Reproductive Biology and Endocrinology201715:20

https://doi.org/10.1186/s12958-017-0237-6

Received: 14 July 2016

Accepted: 3 March 2017

Published: 23 March 2017

Abstract

Background

Repeat breeding directly affects reproductive efficiency in cattle due to an increase in services per conception and calving interval. This study aimed to investigate whether changes in endometrial gene expression profile are involved in repeat breeding in cows. Differential gene expression profiles of the endometrium were investigated during the mid-luteal phase of the estrous cycle between repeat breeder (RB) and non-RB cows using microarray analysis.

Methods

The caruncular (CAR) and intercaruncular (ICAR) endometrium of both ipsilateral and contralateral uterine horns to the corpus luteum were collected from RB (inseminated at least three times but not pregnant) and non-RB cows on Day 15 of the estrous cycle (4 cows/group). Global gene expression profiles of these endometrial samples were analyzed with a 15 K custom-made oligo-microarray for cattle. Immunohistochemistry was performed to investigate the cellular localization of proteins of three identified transcripts in the endometrium.

Results

Microarray analysis revealed that 405 and 397 genes were differentially expressed in the CAR and ICAR of the ipsilateral uterine horn of RB, respectively when compared with non-RB cows. In the contralateral uterine horn, 443 and 257 differentially expressed genes were identified in the CAR and ICAR of RB, respectively when compared with non-RB cows. Gene ontology analysis revealed that genes involved in development and morphogenesis were mainly up-regulated in the CAR of RB cows. In the ICAR of both the ipsilateral and contralateral uterine horns, genes related to the metabolic process were predominantly enriched in the RB cows when compared with non-RB cows. In the analysis of the whole uterus (combining the data above four endometrial compartments), RB cows showed up-regulation of 37 genes including PRSS2, GSTA3 and PIPOX and down-regulation of 39 genes including CHGA, KRT35 and THBS4 when compared with non-RB cows. Immunohistochemistry revealed that CHGA, GSTA3 and PRSS2 proteins were localized in luminal and glandular epithelial cells and stroma of the endometrium.

Conclusion

The present study showed that endometrial gene expression profiles are different between RB and non-RB cows. The identified candidate endometrial genes and functions in each endometrial compartment may contribute to bovine reproductive performance.

Keywords

Repeat breeder Endometrium Caruncle Intercaruncle Microarray Cow

Background

Repeat breeder (RB) is generally defined as any cow that has failed to conceive after at least three inseminations. In both dairy and beef cattle herds, the presence of RB cows can directly lead a large economic loss for producers due to an extension of the length of the open period and frequent artificial insemination (AI) [1]. In addition to management problems such as inadequate estrus detection and AI techniques, various physiological problems of individual cows are one of major causes of repeat breeding. For example, infections of uterus, cervix and/or vagina, dysfunctions of uterus or ovary, obstructed oviducts, defective oocytes and anatomical defects of the reproductive tracts are involved in conception failure, early embryonic death and endocrine disorders of RB animals. [1]. It has been reported that embryo transfer is effective to improve the fertility of RB cows and heifers [2, 3]. On the other hand, a study of reciprocal transfers of embryos between RB and virgin heifers showed that a higher proportion of embryos transferred from RB to virgin heifers than from virgin to RB heifers survived at day 16 to 17, suggesting that the uterine environment in RB heifers is less suitable than in the virgins for supporting a successful embryo development [4]. This became more evident by transfer of identical demi-embryos to RB and virgin recipient heifers resulted less number of morphologically normal and elongated embryos in the RB heifers than in the virgin heifers at day 15 [5]. About an association between alteration of uterine environment and repeat breeding, Katagiri et al. have demonstrated that there is a close relationship between the endometrial epidermal growth factor profile and diminished fertility of RB cows [6].

The molecular mechanisms underlying endometrial function may contribute to reproductive performance in cattle. Increasing evidence using global gene expression analysis has identified numerous differentially expressed genes and related functional pathways in bovine endometrium among highly fertile, subfertile and infertile animal strains during estrous cycle or early pregnancy [710]. Recent studies have also investigated gene expression profiles under various conditions of the bovine endometrium during the estrous cycle and/or during early pregnancy using DNA microarray or RNA sequencing [1118]. In addition, microarray studies have revealed that heat stress and steroid hormones directly affect bovine endometrial gene expression profiles [19, 20].

In ruminants, the endometrium shows structural and physiological differences depending on the uterine compartments. The caruncular (CAR) areas are aglandular and a limited area that forms placentomes by fusing with the fetal extraembryonic membrane [21, 22]. On the other hand, the intercaruncular (ICAR) areas contain endometrial glands that synthesize and secrete substances or factors that are essential for survival and development of the conceptus [23, 24]. A study that directly compared the gene expression profiles of CAR and ICAR during implantation in cows showed 1177 and 453 differentially expressed genes (DEG) were found for cyclic and pregnant animals, respectively [13]. In addition, it has been reported that tissues of the ipsilateral uterine horn to the ovary with the corpus luteum (CL) contain greater quantities of progesterone (P4) and are more sensitive to P4 as compared with tissues on the contralateral side [25]. Although a previous study demonstrated that a few genes show differences in expression between ipsilateral and contralateral uterine horns during the bovine estrous cycle [11], we consider that it is important to analyze each compartment of the bovine endometrium separately in order to understand enodometrial function more comprehensively.

These previous studies suggest that alteration of the endometrial function due to changes in gene expression may contribute to their lower reproductive performance in RB cows, whereas details of the molecular mechanisms and biological pathways of their endometria still need to be elucidated. Thus, we hypothesized that there is a characteristic gene expression profile in the endometrium of the RB cows. This study aimed to investigate differences in gene expression profiles of the endometrium between RB and non-RB cows during the mid-luteal phase of the estrous cycle. In pregnant cattle, maternal recognition of pregnancy occurs around Day 14–15 [26]. In addition, it has been reported that the majority of early embryo losses in cattle have occurred within 16 days of gestation (i.e. during the mid-luteal phase) [27, 28]. Therefore, the basal gene expression profiles of endometrium at mid luteal phase would have the most important association with reproductive performance.

Methods

Animals and sample collection

This study was carried out using non-lactating Japanese Black cows at the institute’s ranch (age: 7.8 ± 0.9 years, parity: 3.3 ± 0.8, open period from last parturition to first AI in this study: 104 ± 9.6 month). Repeat breeder cows (n = 4) were defined based on a previous study by Dochi et al. [3]. Briefly, the RB cows had three characteristics as follows: (1) detectable estrous behavior, but not always normal estrous cycles; (2) not conceiving after three or more inseminations following normal estrous behavior; and (3) healthy uterus and ovaries, as determined by transrectal palpation. Non-RB cows (n = 4) conceived within three inseminations. The non-RB cows were confirmed to be pregnant by transrectal ultrasonography (HS-1500V; Honda Electronics. Co., Aichi, Japan) at 40 days after insemination, then abortion was induced by a single intramuscular injection of 500 μg of prostaglandin F2α (cloprostenol [Dalmazin]; Kyoritsu Seiyaku. Co., Tokyo, Japan) followed by repeated normal estrous cycles at least twice. Both RB and non-RB cows were slaughtered on Day 15 of the estrous cycle (the day of estrus was designated as Day 0) and the uterus and both ovaries together were collected. Uterine horns were identified as ipsilateral to the ovary containing the CL or contralateral. We collected CAR and ICAR in the endometrium from the middle area of each uterine horns. The uterine horns were cut opened longitudinally using scissors and CAR were carefully dissected first not to include ICAR, subsequently, ICAR areas were cut off. Collected samples were snap-frozen in liquid nitrogen and stored at −80 °C until RNA extraction. Whole cross section of the uterus for immunohistochemistry were collected from the middle area of ipsilateral uterine horn of all cows and fixed in 10% formalin (v/v), embedded in paraffin wax, and then stored at 4 °C until use. All procedures in animal experiments were carried out in accordance with guidelines approved by the Animal Ethics Committee of the National Institute of Agrobiological Sciences for the use of animals (permission number: H18-036).

Microarray analysis

Total RNA was extracted from each sample by acid guanidinium thiocyanate-phenol-chloroform with ISOGEN (Nippon Gene, Tokyo, Japan) according to the manufacturer’s instructions. All RNA samples were then treated with TURBO DNase (TURBO DNA-free™ Kit, Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s instructions to remove contaminating genomic DNA. The quantity and quality of the total RNA samples were assessed using a NanoDrop spectrophotometer (ND-1000; NanoDrop Technology Inc., Wilmington, DE, USA) and an Experion automated electrophoresis system with an Experion RNA StdSens kit (Bio-Rad Laboratories, Hercules, CA, USA), respectively. A custom-made bovine oligonucleotide microarray with 15,000 unique genes (GPL9284) fabricated by Agilent Technologies (Santa Clara, CA, USA) was used in this study, which was performed as described previously [29]. Sixty-mer nucleotide probes for the customized microarray were synthesized on a glass slide. We performed one-color microarray analysis. cDNA synthesis, Cy3-labeled cRNA preparation, hybridization, and the washing and scanning of array slides were performed according to the Agilent one color microarray-based gene expression analysis protocol. Briefly, 400 ng of total RNA from each sample were reverse-transcribed into cDNA using the Quick Amp Labeling Kit (Agilent Technologies) with an oligo dT-based primer, and then Cy3-labelled cRNA was prepared by in vitro transcription. Labeled cRNA was purified with an RNeasy Mini Kit (Qiagen, Hilden, Germany), and the concentration and Cy3 dye incorporation (pmol Cy3/μg cRNA) were measured with a spectrophotometer. Labeled cRNA (600 ng) was fragmented and hybridized using the Gene Expression Hybridization Kit (Agilent Technologies), according to the manufacturer’s instructions. The arrays were washed using a Gene Expression Wash Pack Kit (Agilent Technologies) and scanned using an Agilent Microarray Scanner. Feature Extraction ver. 9.5 was used for image analysis and data extraction. Microarray data from each sample were imported into GeneSpring 12 (Agilent Technologies) for further data characterization. The GEO accession numbers are as follows. Platform: GPL9284; samples: GSM2093338 to GSM2093369; series: GSE79367. To identify putative biological functions of DEG between RB and non-RB cows in each endometrial compartment, we performed functional annotation chart analysis of the lists of DEG using the Database for Annotation, Visualization and Integrated Discovery (DAVID; http://david.abcc.ncifcrf.gov/) based on Genebank Accession IDs [30]. Gene Ontology (GO) Biological Process was selected as the functional annotation category for the analysis with the threshold for minimum gene counts belonging to an annotation term set to 5 and an EASE score set to 0.05. The GO terms were ranked according to their P-values describing the significance of gene-term enrichment.

Quantitative real-time RT-PCR analysis

To validate the results of microarray analysis, we confirmed mRNA expression of the following representative genes using quantitative real-time RT-PCR (qPCR) analysis: (1) top two up- or down-regulated known genes in each endometrial compartment; and (2) top five up- or down-regulated known genes in the whole uterus. Details of the procedures for single-strand cDNA synthesis and qPCR were previously described [31]. Briefly, 50 ng of total RNA from the same sample used for the microarray were reverse-transcribed into cDNA for 30 min at 48 °C using MultiScribeTM Reverse Transcriptase (Applied Biosystems, Foster City, CA, USA) with a random primer, dNTP mixture, MgCl2 and RNase inhibitor. After heat inactivation of the reverse transcriptase for 5 min at 95 °C, PCR and resulting relative increase in reporter fluorescent dye emission were monitored in real time using an Mx3000P qPCR system (Agilent Technologies). Primers were designed using Primer Express computer software program (Applied Biosystems) or Primer3 Plus software (www.bioinformatics.nl/primer3plus/) based on the bovine sequences. The primer sequences for each gene are listed in Table 1. Thermal-cycling conditions included an initial sample incubation at 50 °C for 2 min and at 95 °C for 10 min, followed by 40 cycles at 95 °C for 15 s and at 60 °C for 1 min. The cycle threshold value (CT) indicate the quantity of the target gene in each sample. The relative difference in initial amount of each mRNA species (or cDNA) was determined by comparing the CT values. The standard curves for each gene were generated by serially diluting plasmids containing cDNA of each individual gene to quantify the mRNA concentrations. We confirmed the utility of the dissociation curve for detecting the SYBR Green-based objective amplicon because SYBR Green also detects double-stranded DNA including Primer dimers, contaminating DNA and PCR products from misannealed primers. Non-specific amplicons appear as a peak separate from the desired amplicon peak. The expression ratio of each gene to SUZ12 mRNA, which has been demonstrated to be suitable for normalization in bovine endometrial tissue [32], was calculated to adjust for any variations in the qPCR reaction.
Table 1

Details of the primers used for quantitative real-time RT-PCR analysis

Gene (GenBank accession number)

Primer

Sequence

Position

CHGA

Forward

5′-GCCGAAAGAGGTGACAGAAGA-3′

538-558

(NM_181005)

Reverse

5′-GTCTCCGTCCGAGTCTTCATC-3′

637-617

CNGA1

Forward

5′-AGCAGAGATCGCCATCAATGT-3′

1574-1594

(NM_174278)

Reverse

5′-ACCAACTCCACCAACAGACCA-3′

1663-1643

CPXM2

Forward

5′- ACCAGTGGATTGAAGTGGACG-3′

581-601

(NM_001206057)

Reverse

5′- TCACTCAGCCAGAGTGAGTTCCT-3′

665-643

FAM83D

Forward

5′- GGCTCCTACAGTTTTACATGGACAG-3′

788-812

(NM_001083393)

Reverse

5′-CAACCACTTGGCCAGACAGAA-3′

863-843

FMO2

Forward

5′- AAGCCAGACATCCTTTCTCTCTTG -3′

1459-1482

(NM_001163274)

Reverse

5′- CCCAACCAGGCGATACTGATA-3′

1554-1532

GSTA3

Forward

5′-AGAGCCATCCTCAGCTACCTTG-3′

254-275

(NM_001077112)

Reverse

5′-TCGATCCTGACTGTCTCCTTCA-3′

327-306

IFIH1

Forward

5′-GGGACTAACAGCTTCACCAGGT-3′

1764-1785

(XM_002685338)

Reverse

5′-GGTAACTGCATCAAGATTGGCA-3′

1860-1839

IGG1C

Forward

5′-ACCAAGGTGGACAAGGCTGTT-3′

274-294

(S82409)

Reverse

5′-GGAAGATGAAGACAGAGGGTCCT-3′

370-348

KCNA2

Forward

5′-TGGGTTCCCTATGTGCAATTG-3′

1644-1664

(NM_001101195)

Reverse

5′-TCCCGGTGGTAGAAGTAGTTGAA-3′

1734-1712

KLHL24

Forward

5′- TTATTGGCAAGGAGGAGATGGT-3′

901-922

(NM_001206196)

Reverse

5′- TCTCAGATCAACAGCGCGAT-3′

968-949

KRT35

Forward

5′- GAGACCGAGGTATCCATGCG-3′

587-606

(NM_001076073)

Reverse

5′- TTCTTGAGGCAGAGCAGCTC -3′

726-707

LPLUNC1

Forward

5′- TCGGTGTGTTCAACCCTAAGC-3′

1280-1300

(NM_174697)

Reverse

5′- TTCTCGTTTGGCAGCAGGAT -3′

1355-1336

PIPOX

Forward

5′- ACAGCATTAACACCGAGTCGG-3′

2140-2160

(NM_001014878)

Reverse

5′- GGCAGTTATGAGCCTGTTTCCT-3′

2210-2189

PLEKHA5

Forward

5′- GATGGATTCAAGAACGGAACG-3′

2655-2675

(XM_002687754)

Reverse

5′- TTCCACAGTCATCCTAGGTCGA-3′

2739-2718

PRF1

Forward

5′-CAAGCCAAATGCTAATGTCCGT-3′

408-429

(NM_001143735)

Reverse

5′-AAAGCGACACTCCACTAAGTCCAT-3′

531-508

PRSS2

Forward

5′-GTGAGGCTGGGAGAATACAACA-3′

211-232

(NM_174690)

Reverse

5′-ATGATCTTGGACGCATCGATGA-3′

281-260

SLC39A2

Forward

5′- TTGGCTGCCTATTTGCCCT-3′

355-373

(NM_001205648)

Reverse

5′- CTGGAACCACTTGAAGCAGATG-3′

428-407

THBS4

Forward

5′- CACTCTGAACGAGCTCTACGTGAT 3′

331-354

(NM_001034728)

Reverse

5′- GAAGAGTAAAGGCCGAAGATGGT-3′

411-389

SUZ12

Forward

5′-GAACACCTATCACACACATTCTTGT-3′

1565-1589

(NM_001205587)

Reverse

5′-TAGAGGCGGTTGTGTCCACT-3′

1694-1675

Immunohistochemistry

Immunohistochemistry for chromogranin A (CHGA), glutathione S-transferase A3 (GSTA3) and trypsin 2 (PRSS2) was performed in the endometrium of both RB and non-RB cows on Day 15 of the estrous cycle using the automated Ventana HX System Discovery with a DabMapKit (Roche Diagnostics, Basel, Switzerland) as described previously in detail by our laboratory [33]. Uterine cross sections 7-μm-thick were incubated at room temperature with rabbit polyclonal anti-human CHGA antibody (1.0 mg/ml, 20085, ImmunoStar Inc., Hudson, WI, USA), rabbit polyclonal anti-human GSTA3 antibody (0.5 mg/ml, orb5362, Biorbyt LLC, San Francisco, CA, USA) or rabbit polyclonal anti-bovine PRSS2 antibody (10 mg/ml, OASA07087, Aviva Systems Biology, San Diego, CA, USA) diluted 1:100 (anti-CHGA), 1:20 (anti-GSTA3) or 1:200 (anti-PRSS2) in Discovery Ab diluents (Roche) for 12 h. The signals were detected using anti-rabbit IgG-Biotin conjugate (Sigma) diluted 1:500 for 1 h. Negative controls were performed using normal rabbit IgG (0.5 mg/ml, 20304, Imgenex, San Diego, CA, USA) diluted at concentrations equivalent to the primary antibodies. The sections were observed with a Leica DMRE HC microscope (Leica Microsystems, Wetzlar, Germany) and a Nikon Digital Sight DS-Fi1-L2 (Nikon Instruments Co., Tokyo, Japan).

Statistical analysis

Microarray data were analyzed statistically with an unpaired Student’s t-test and summarized using GeneSpring 12 (Agilent Technologies). The analysis of each uterine compartment was performed by comparing the gene datasets which composed by microarray data of four cows in each RB and non-RB group (n = 4/group). The analysis of whole uterus was performed by comparing the gene datasets which composed by microarray data of all four compartments of four cows in each RB and non-RB group (n = 16/group). The qPCR results were analyzed using a Mann–Whitney U test. Results are presented as the mean ± SEM. Statistical significance is considered to be at P < 0.05.

Results

Gene expression profiles of CAR and ICAR in ipsilateral uterine horns

A total of 405 and 397 genes were differentially expressed in CAR and ICAR of the ipsilateral uterine horn of RB cows, respectively when compared with non-RB cows (adjusted P-value <0.05, fold-change >1.0). All data of individual gene changes in CAR and ICAR are available in Additional file 1: Tables S1 and S2, respectively. Out of these, 128 genes were up-regulated and 277 genes were down-regulated in CAR, whereas 169 genes were up-regulated and 228 genes were down-regulated in ICAR. The top 10 up- and down-regulated known genes in CAR are shown in Table 2. The most pronounced up- and down-regulation of gene expression in RB cows was observed for GSTA3 (Glutathione S-transferase, alpha 3; 19.2-fold) and CPXM2 (Carboxypeptidase X (M14 family), member 2; 5.3-fold), respectively. The top five functional annotations of DEG in the CAR of ipsilateral uterine horns between RB and non-RB cows are listed in Table 3. The GO terms involved in anatomical structure development, developmental process, cellular process, multicellular organismal development and biosynthetic process were highly enriched in up-regulated genes, whereas the GO terms involved in cellular process, cytoskeleton organization, biological adhesion, cell adhesion and cellular component organization were highly enriched in down-regulated genes.
Table 2

Top 10 up- and down-regulated known genes in CAR of ipsilateral uterine horns of RB cows

GenBank accession ID

Gene symbol

Gene description

Fold change

P-value

Up-regulated genes

 NM_001077112

GSTA3

Glutathione S-transferase, alpha 3

19.2

0.0016

 NM_001206196

KLHL24

Kelch-like 24 (Drosophila)

3.0

0.0273

 XM_588022

SPOPL

Speckle-type POZ protein-like

2.8

0.0239

 NM_001103317

ERCC2

Excision repair cross-complementing rodent repair deficiency, complementation group 2

2.5

0.0437

 XM_002696037

CD300LG

CD300 molecule-like family member g

2.2

0.0378

 NM_001075908

STK33

Serine/threonine kinase 33

2.1

0.0351

 NM_174607

SLC5A3

Solute carrier family 5 (inositol transporters), member 3

2.0

0.0126

 NM_001192523

KCNMB4

Potassium large conductance calcium-activated channel, subfamily M, beta member 4

2.0

0.0307

 NM_001083638

MEF2A

Myocyte enhancer factor 2A

2.0

0.0290

 XM_002695445

ZNF211

Zinc finger protein 211

2.0

0.0063

Down-regulated genes

 NM_001206057

CPXM2

Carboxypeptidase X (M14 family), member 2

5.3

0.0496

 NM_001076073

KRT35

Keratin 35

4.1

0.0279

 NM_001101239

GRP

Gastrin-releasing peptide

3.6

0.0319

 NM_001245926

FGF9

Fibroblast growth factor 9

3.5

0.0066

 NM_174145

PKP1

Plakophilin 1 (ectodermal dysplasia/skin fragility syndrome)

2.9

0.0021

 NM_001076864

TMEM129

Transmembrane protein 129

2.6

0.0087

 NM_001105478

SSLP1

Secreted seminal-vesicle Ly-6 protein 1

2.5

0.0474

 NM_001077962

STAC

SH3 and cysteine rich domain

2.4

0.0157

 NM_001077945

PFN3

Profilin 3

2.4

0.0106

 NM_001012685

FCAR

Fc fragment of IgA, receptor for

2.3

0.0322

Table 3

Top 5 functional annotations of up- and down-regulated genes in CAR of ipsilateral uterine horns

Term

Count

P-value

Up-regulated genes

 GO:0048856 ~ anatomical structure development

11

0.0029

 GO:0032502 ~ developmental process

11

0.0161

 GO:0009987 ~ cellular process

31

0.0186

 GO:0007275 ~ multicellular organismal development

10

0.0230

 GO:0009888 ~ tissue development

5

0.0246

Down-regulated genes

 GO:0009987 ~ cellular process

95

<0.0001

 GO:0007010 ~ cytoskeleton organization

8

0.0061

 GO:0022610 ~ biological adhesion

11

0.0065

 GO:0007155 ~ cell adhesion

11

0.0065

 GO:0016043 ~ cellular component organization

23

0.0099

The top 10 up- and down-regulated known genes in ICAR are shown in Table 4. The highest increase and decrease in gene expression in RB cows were observed in LPLUNC1 (Von Ebner minor salivary gland protein; 3.7-fold) and THBS4 (Thrombospondin 4; 3.4-fold), respectively. Table 5 summarizes the top five functional annotations of DEG in ICAR between RB and non-RB cows. As a result of DAVID analysis, only four GO terms related to metabolic process, cellular metabolic process, cellular biosynthetic process and chemical homeostasis were identified in up-regulated genes. In down-regulated genes, the GO terms involved in metabolic process, cellular metabolic process, cellular process, primary metabolic process and protein metabolic process were highly enriched.
Table 4

Top 10 up- and down-regulated known genes in ICAR of ipsilateral uterine horns of RB cows

GenBank accession ID

Gene symbol

Gene description

Fold change

P-value

Up-regulated genes

 NM_174697

LPLUNC1

Von Ebner minor salivary gland protein

3.7

0.0214

 NM_001075162

FMO2

Flavin containing monooxygenase 2 (non-functional)

3.3

0.0348

 NM_001166616

C5

Complement component 5

3.2

0.0429

 XM_002692160

FOXA2

Forkhead box A2

3.0

0.0350

 NM_181027

AKR1C4

Aldo-keto reductase family 1, member C4 (chlordecone reductase; 3-alpha hydroxysteroid dehydrogenase, type I; dihydrodiol dehydrogenase 4)

2.9

0.0104

 NM_001045878

GATM

Glycine amidinotransferase (L-arginine:glycine amidinotransferase)

2.8

0.0472

 NM_001206196

KLHL24

Kelch-like 24 (Drosophila)

2.6

0.0301

 NM_001034419

HPGD

Hydroxyprostaglandin dehydrogenase 15-(NAD)

2.6

0.0293

 XM_001254052

ZNED1

DNA-directed RNA polymerase I subunit RPA12-like

2.4

0.0476

 NM_001038096

CFI

Complement factor I

2.4

0.0096

Down-regulated genes

 NM_001034728

THBS4

Thrombospondin 4

3.4

0.0106

 NM_001083393

FAM83D

Protein FAM83D

2.6

0.0011

 NM_001105411

GFRA1

GDNF family receptor alpha 1

2.4

0.0391

 NM_001206057

CPXM2

Carboxypeptidase X (M14 family), member 2

2.3

0.0231

 NM_178572

CA2

Carbonic anhydrase II

2.3

0.0474

 NM_001099381

GALK1

Galactokinase 1

2.1

0.0466

 NM_001035050

VTN

Vitronectin

2.0

0.0464

 NM_174745

MMP2

Matrix metallopeptidase 2 (gelatinase A, 72 kDa gelatinase, 72 kDa type IV collagenase)

1.9

0.0387

 NM_001075730

STRA6

Stimulated by retinoic acid gene 6

1.9

0.0405

 NM_174558

KCNK17

Potassium channel, subfamily K, member 17

1.9

0.0496

Table 5

Top 5 functional annotations of up- and down-regulated genes in ICAR of ipsilateral uterine horns

Term

Count

P-value

Up-regulated genes

 GO:0008152 ~ metabolic process

38

0.0033

 GO:0044237 ~ cellular metabolic process

29

0.0242

 GO:0044249 ~ cellular biosynthetic process

15

0.0345

 GO:0048878 ~ chemical homeostasis

5

0.0423

Down-regulated genes

 GO:0008152 ~ metabolic process

66

<0.0001

 GO:0044237 ~ cellular metabolic process

8

<0.0001

 GO:0009987 ~ cellular process

11

0.0001

 GO:0044238 ~ primary metabolic process

11

0.0009

 GO:0019538 ~ protein metabolic process

23

0.0023

Gene expression profiles of CAR and ICAR in contralateral uterine horns

A total of 443 and 257 genes were differentially expressed in CAR and ICAR of the contralateral uterine horn of RB cows, respectively when compared with non-RB cows (adjusted P-value <0.05, fold-change >1.0). All data of individual gene changes in CAR and ICAR are available in Additional file 1: Tables S3 and S4, respectively. Out of these, 333 genes were up-regulated and 110 genes were down-regulated in CAR, whereas 121 genes were up-regulated and 136 genes were down-regulated in ICAR. The top 10 up- and down-regulated known genes in CAR are shown in Table 6. Similar to CAR of the ipsilateral side, the most pronounced up-regulated gene in RB cows was GSTA3 (Glutathione S-transferase, alpha 3; 12.7-fold). The most down-regulated gene in RB cows was SLC39A2 (Solute carrier family 39 (zinc transporter), member 2; 2.7-fold). Table 7 shows the top five functional annotations of DEG in CAR between RB and non-RB cows. Biological functions of positive regulation of biological process, positive regulation of cellular process, organ morphogenesis, anatomical structure morphogenesis, and anatomical structure development were highly enriched in up-regulated genes, whereas biological functions of regulation of protein kinase activity, regulation of kinase activity, regulation of transferase activity and carboxylic acid metabolic process were highly enriched in down-regulated genes.
Table 6

Top 10 up- and down-regulated known genes in CAR of contralateral uterine horns of RB cows

GenBank accession ID

Gene symbol

Gene description

Fold change

P-value

Up-regulated genes

 NM_001077112

GSTA3

Glutathione S-transferase, alpha 3

12.7

0.0080

 NM_001014878

PIPOX

Pipecolic acid oxidase

8.4

0.0261

 NM_001024569

ELF5

E74-like factor 5 (ets domain transcription factor)

4.3

0.0173

 NM_173981

ACAN

Aggrecan

3.0

0.0420

 NM_174404

NRXN1

Neurexin 1

3.0

0.0065

 NM_001079771

SMOC1

SPARC related modular calcium binding 1

2.7

0.0104

 NM_001034351

TNNC1

Troponin C type 1 (slow)

2.6

0.0142

 NM_173945

NTS

Neurotensin

2.6

0.0289

 NM_001206196

KLHL24

Kelch-like 24 (Drosophila)

2.4

0.0345

 NM_001046585

CCL14

Chemokine (C-C motif) ligand 14

2.4

0.0358

Down-regulated genes

 NM_001205648

SLC39A2

Solute carrier family 39 (zinc transporter), member 2

2.7

0.0110

 XM_002687754

PLEKHA5

Pleckstrin homology domain containing, family A member 5

2.2

0.0181

 NM_001077962

STAC

SH3 and cysteine rich domain

2.0

0.0456

 NM_001098061

SQLE

Squalene epoxidase

2.0

0.0268

 NM_174145

PKP1

Plakophilin 1 (ectodermal dysplasia/skin fragility syndrome)

1.9

0.0304

 NM_001098938

CYP39A1

Cytochrome P450, family 39, subfamily A, polypeptide 1

1.9

0.0262

 NM_174489

VLDLR

Very low density lipoprotein receptor

1.9

0.0063

 NM_001034660

SLC5A11

Solute carrier family 5 (sodium/glucose cotransporter), member 11

1.8

0.0061

 NM_001075803

FH

Fumarate hydratase

1.8

0.0009

 NM_001099399

CMTM3

CKLF-like MARVEL transmembrane domain containing 3

1.8

0.0434

Table 7

Top 5 functional annotations of up- and down-regulated genes in CAR of contralateral uterine horns

Term

Count

P-value

Up-regulated genes

 GO:0048518 ~ positive regulation of biological process

25

<0.0001

 GO:0048522 ~ positive regulation of cellular process

22

<0.0001

 GO:0009887 ~ organ morphogenesis

12

<0.0001

 GO:0009653 ~ anatomical structure morphogenesis

16

0.0001

 GO:0048856 ~ anatomical structure development

24

0.0002

Down-regulated genes

 GO:0045859 ~ regulation of protein kinase activity

5

0.0029

 GO:0043549 ~ regulation of kinase activity

5

0.0035

 GO:0051338 ~ regulation of transferase activity

5

0.0040

 GO:0043436 ~ oxoacid metabolic process

7

0.0075

 GO:0019752 ~ carboxylic acid metabolic process

7

0.0075

Table 8 shows the top 10 up- and down-regulated known genes in ICAR. The highest increase and decrease in gene expression in RB cows were found for PIPOX (Pipecolic acid oxidase; 8.8-fold) and IFIH1 (Interferon induced with helicase C domain 1; 4.0-fold), respectively. The top five functional annotations of DEG in the ICAR of contralateral uterine horns between RB and non-RB cows are listed in Table 9. The GOs containing genes regulating gene expression, regulation of primary metabolic process, regulation of macromolecule metabolic process, metabolic process and regulation of metabolic process were highly enriched in up-regulated genes. In down-regulated genes, the GO terms involved in primary metabolic process, transport, establishment of localization, localization and metabolic process were highly enriched.
Table 8

Top 10 up- and down-regulated known genes in ICAR of contralateral uterine horns of RB cows

GenBank accession ID

Gene symbol

Gene description

Fold change

P-value

Up-regulated genes

 NM_001014878

PIPOX

Pipecolic acid oxidase

8.8

0.0156

 NM_174278

CNGA1

Cyclic nucleotide gated channel alpha 1

6.8

0.0390

 NM_001033608

GSTA3

Glutathione S-transferase, alpha 3

6.6

0.0340

 NM_001046400

MIF

Macrophage migration inhibitory factor (glycosylation-inhibiting factor)

3.1

0.0118

 NM_001046400

ZNRD1

Zinc ribbon domain containing 1

2.8

0.0400

 NM_001206196

KLHL24

Kelch-like 24 (Drosophila)

2.6

0.0212

 NM_001076517

LY6D

Lymphocyte antigen 6 complex, locus D

2.5

0.0414

 NM_001035473

GK5

Glycerol kinase 5

2.2

0.0210

 NM_001075890

KLK10

Kallikrein-related peptidase 10

2.1

0.0445

 NM_001083791

SH3BGRL2

SH3 domain binding glutamic acid-rich protein like 2

1.9

0.0030

Down-regulated genes

 XM_002685338

IFIH1

Interferon induced with helicase C domain 1

4.0

0.0485

 NM_001101195

KCNA2

Potassium voltage-gated channel, shaker-related subfamily, member 2

3.5

0.0204

 NM_180998

LTF

Lactotransferrin

2.9

0.0286

 NM_001076843

SLC30A3

Solute carrier family 30 (zinc transporter), member 3

2.6

0.0289

 NM_001076494

C8H8orf13

Chromosome 8 open reading frame 13 ortholog

2.5

0.0406

 NM_001105411

GFRA1

GDNF family receptor alpha 1

2.5

0.0383

 NM_174018

CFTR

Cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)

2.5

0.0316

 NM_001077941

MARCH3

Membrane-associated ring finger (C3HC4) 3

2.5

0.0158

 NM_173959

SCD

Stearoyl-CoA desaturase (delta-9-desaturase)

2.0

0.0096

 NM_174602

SLC2A1

Solute carrier family 2 (facilitated glucose transporter), member 1

1.9

0.0057

Table 9

Top 5 functional annotations of up- and down-regulated genes in ICAR of contralateral uterine horns

Term

Count

P-value

Up-regulated genes

 GO:0010467 ~ gene expression

17

0.0004

 GO:0080090 ~ regulation of primary metabolic process

19

0.0013

 GO:0060255 ~ regulation of macromolecule metabolic process

19

0.0015

 GO:0008152 ~ metabolic process

38

0.0033

 GO:0019222 ~ regulation of metabolic process

19

0.0040

Down-regulated genes

 GO:0044238 ~ primary metabolic process

34

0.0023

 GO:0006810 ~ transport

17

0.0025

 GO:0051234 ~ establishment of localization

17

0.0026

 GO:0051179 ~ localization

18

0.0027

 GO:0008152 ~ metabolic process

35

0.0028

Gene expression profiles of whole uterus

To characterize differential global gene expression profiles in the endometrium of RB and non-RB cows not only locally in each endometrial compartment but also globally in the uterus, we also performed bioinformatics analysis by combining the microarray gene data sets of four endometrial compartments in each cow as whole uterus. A total of 76 genes were found to be differentially expressed in the whole uterus of RB cows when compared with non-RB cows (adjusted P-value <0.05, fold-change >2.0). Among these, 37 genes were up-regulated and 39 genes were down-regulated. All up- and down-regulated known genes in the whole uterus are shown in Table 10. The most pronounced up- and down-regulated gene expression in RB cows was found for PRSS2 (Protease, serine, 2 (trypsin 2); 12.3-fold) and CHGA (Chromogranin A (parathyroid secretory protein 1); 3.9-fold), respectively.
Table 10

Up- and down-regulated known genes in whole uterus of RB cows as compared with non-RB cows

GenBank accession ID

Gene symbol

Gene description

Fold change

P-value

Up-regulated genes

 NM_174690

PRSS2

Protease, serine, 2 (trypsin 2)

12.3

0.0018

 NM_001077112

GSTA3

Glutathione S-transferase, alpha 3

6.7

0.0002

 NM_001014878

PIPOX

Pipecolic acid oxidase

6.4

<0.0001

 NM_174278

CNGA1

Cyclic nucleotide gated channel alpha 1

4.3

0.0024

 S82409

IGG1C

IgG1 heavy chain constant region

3.7

0.0081

 BC112657

Vl1a

Immunoglobulin lambda light chain variable region

3.7

0.0076

 S82407

IgCgamma

IgG2a heavy chain constant region

3.4

0.0347

 NM_001025346

DAPL1

death associated protein-like 1

3.4

0.0075

 NM_001080353

PI3

Peptidase inhibitor 3, skin-derived (SKALP)

3.2

0.0022

 NM_001166616

C5

Complement component 5

2.8

0.0044

 NM_001024569

ELF5

E74-like factor 5 (ets domain transcription factor)

2.8

0.0047

 NM_001075910

CCDC113

Coiled-coil domain containing 113

2.7

0.0432

 NM_173945

NTS

Neurotensin

2.6

<0.0001

 NM_001034351

TNNC1

Troponin C type 1 (slow)

2.5

0.0004

 NM_001206196

KLHL24

Kelch-like 24 (Drosophila)

2.5

<0.0001

 NM_001046400

ZNRD1

zinc ribbon domain containing 1

2.3

<0.0001

 NM_001193109

SDCCAG8

Serologically defined colon cancer antigen 8

2.2

0.0001

 NM_174010

CD36

CD36 molecule (thrombospondin receptor)

2.2

0.0073

 XM_588022

SPOPL

Speckle-type POZ protein-like

2.2

<0.0001

 NM_173880

H4

Histone H4

2.1

0.0033

 NM_001098155

ZNF322A

Zinc finger protein 322A

2.1

0.0005

 NM_001035380

GC

Group-specific component (vitamin D binding protein)

2.0

0.0269

 NM_001035473

GK5

Glycerol kinase 5

2.0

0.0003

Down-regulated genes

 NM_181005

CHGA

Chromogranin A (parathyroid secretory protein 1)

3.9

0.0005

 NM_001076073

KRT35

Keratin 35

3.3

0.0011

 NM_001034728

THBS4

Thrombospondin 4

3.2

<0.0001

 NM_001206057

CPXM2

Carboxypeptidase X (M14 family), member 2

3.1

<0.0001

 NM_001143735

PRF1

Perforin 1 (pore forming protein)

3.0

0.0090

 NM_001002763

CDH1

Cadherin 1, type 1, E-cadherin (epithelial)

2.9

0.0097

 NM_176851

FUT5

Fucosyltransferase 5 (alpha (1,3) fucosyltransferase)

2.7

0.0038

 XM_002685338

IFIH1

Interferon induced with helicase C domain 1

2.5

0.0040

 NM_001081734

MOCS3

Molybdenum cofactor synthesis 3

2.5

0.0465

 NM_174039

DPP4

Dipeptidyl-peptidase 4

2.4

0.0158

 NM_001102080

CSNK1D

Casein kinase 1, delta

2.3

0.0144

 NM_001102060

TBC1D10C

TBC1 domain family, member 10C

2.3

0.0391

 NM_001081539

C11H2orf49

Chromosome 11 open reading frame, human C2orf49

2.3

0.0354

 AF068848

VpreB

Surrogate light chain

2.3

0.0204

 NM_001127317

MIC1

Major histocompatibility class I related protein

2.2

0.0135

 NM_205801

CLDN3

Claudin 3

2.2

0.0196

 NM_001077887

CLASRP

CLK4-associating serine/arginine rich protein

2.2

0.0245

 NM_174513

ADAP1

ArfGAP with dual PH domains 1

2.1

0.0169

 NM_001105478

SSLP1

Secreted seminal-vesicle Ly-6 protein 1

2.1

0.0004

 NM_001077962

STAC

SH3 and cysteine rich domain

2.1

<0.0001

 XM_002687754

PLEKHA5

Pleckstrin homology domain containing, family A member 5

2.1

0.0003

 NM_001101239

GRP

Gastrin-releasing peptide

2.1

0.0059

 NM_001205648

SLC39A2

Solute carrier family 39 (zinc transporter), member 2

2.0

0.0001

Validation of gene expression by qPCR

We selected the top two and top five up- and down-regulated known genes in each endometrial compartment and whole uterus between RB and non-RB cows, respectively to validate the changes in gene expression obtained from microarray analysis by qPCR. qPCR analysis clearly confirmed the microarray results in each endometrial compartment except for FAM83D (Fig. 1h), SLC39A2 (Fig. 2c), PLEKHA5 (Fig. 2d) and IFIH1 (Fig. 2g). In the whole uterus, the microarray results were confirmed except for PRF1 (Fig. 3j).
Fig. 1

qPCR analysis of top two up- and down-regulated known genes in ipsilateral uterine horns between RB and non-RB cows for validation of the gene expression changes obtained from microarray analysis. a, b, c and d CAR and e, f, g and h ICAR. a, b, e and f up-regulated known genes in RB cows when compared with non-RB cows. c, d, g and h) down-regulated known genes in RB cows when compared with non-RB cows. The expression of mRNA was normalized to the expression of SUZ12 measured in the same RNA preparation. Data are shown as the mean ± SEM. Asterisks show significant differences (P < 0.05)

Fig. 2

qPCR analysis of top two up- and down-regulated known genes in contralateral uterine horns between RB and non-RB cows for validation of the gene expression changes obtained from microarray analysis. a, b, c and d CAR and e, f, g and h ICAR. a, b, e and f up-regulated known genes in RB cows when compared with non-RB cows. c, d, g and h down-regulated known genes in RB cows when compared with non-RB cows. The expression of mRNA was normalized to the expression of SUZ12 measured in the same RNA preparation. Data are shown as the mean ± SEM. Asterisks show significant differences (P < 0.05)

Fig. 3

qPCR analysis of top five up- and down-regulated known genes in whole uterus between RB and non-RB cows for validation of the gene expression changes obtained from microarray analysis. a, b, c, d, e up-regulated known genes in RB cows when compared with non-RB cows. f, g, h, i, j down-regulated known genes in RB cows when compared with non-RB cows. The expression of mRNA was normalized to the expression of SUZ12 measured in the same RNA preparation. Data are shown as the mean ± SEM. Asterisks show significant differences (P < 0.05)

Protein localization of CHGA, GSTA3 and PRSS2 in the endometrium of RB and non-RB cows

Figure 4 shows the results of immunohistochemistry for CHGA, GSTA3 and PRSS2 in the endometrial tissues of ipsilateral uterine horns of RB and non-RB cows on Day 15 of the estrous cycle. In both RB and non-RB cows, a distinct CHGA signal was found in the uterine luminal epithelium and a part of uterine stroma under the epithelium (Fig. 4a and c). CHGA protein was also detected moderately in the glandular epithelium in both RB and non-RB cows and in the uterine stroma in RB cows (Fig. 4b and d). A positive GSTA3 signal was detected in the uterine luminal, uterine stroma and glandular epithelium in RB cows (Fig. 4e and f), whereas positive staining was not observed in non-RB cows (Fig. 4g and h). PRSS2 protein was moderately detected in the uterine luminal epithelium and glandular epithelium, and partially intense staining was observed in the uterine stroma under the epithelium in both RB and non-RB cows (Fig. 4i,j,k and l).
Fig. 4

Representative photomicrographs of protein localization of CHGA, GSTA3 and PRSS2 in endometrial tissue from RB and non-RB cows on Day 15 of estrous cycle. Protein localization of (a, b, c and d) CHGA, (e, f, g and h) GSTA3 and (i, j, k and l) PRSS2 in endometrial tissue from RB (a, b, e, f, i and j) and non-RB (c, d, g, h, k and l) cows was detected by immunohistochemistry. Seven-micrometer sections of bovine endometrial tissues of ipsilateral uterine horns on Day 15 of estrous cycle were immunostained with anti-human CHGA, anti-human GSTA3 and anti-bovine PRSS2 polyclonal antibodies. Positive staining of CHGA and PRSS2 were found in the uterine luminal epithelium, uterine stroma and glandular epithelium of both RB and non-RB cows. GSTA3 was detected in the uterine luminal, uterine stroma and glandular epithelium in RB cows, whereas positive staining was not observed in non-RB cows. No signal was detected in the negative control sections using normal rabbit IgG (inserted panels). LE, luminal epithelium; US, uterine stroma; GE, glandular epithelium. Scale bars = 50 μm

Discussion

This is the first study to investigate global gene expression profiles of endometrium between RB and non-RB cows in both each endometrial compartments and the whole uterus. As we hypothesized, the microarray analysis identified a number of characteristic up- and down-regulated genes specific to each of four endometrial compartments of RB cows. The RB cows used in this study had experienced pregnancy and then became infertile. Thus, long-term infertility in the RB cows may be associated with alteration of endometrial function. Our results support that alteration of uterine environment, which may be induced by changes in the endometrial gene expression, could be a possible involvement of low fertility in the RB cattle.

Even though the endometrial gene expression profiles were regionally different in the endometrial compartments, GSTA3 was identified as the most pronounced up-regulated gene in the CAR of both ipsilateral and contralateral uterine horn. GSTA3 is a member of the class Alpha GST isoenzymes which exert a critical role in the detoxification of electrophilic decomposition products generated by reactive oxygen species (ROS) and metabolism of xenobiotics through glutathione conjugation with electrophilic compounds [3437]. Similar to our results, a recent study has demonstrated that cows with low endometrial receptivity of the embryo show a higher expression of several oxidative stress-response genes in the endometrium compared with highly receptive cows at Day 7 of the estrous cycle [7]. Both oxidative stress and xenobiotics are directly responsible for not only an increase in embryonic mortality but also an alteration of uterine function inducing severe gynecological diseases such as endometriosis and preeclampsia [3842]. We suppose that the CAR of RB cows may be accompanied by enhanced detoxification and elimination of ROS and xenobiotics. Another important contribution of GSTA3 isomerase is in the biosynthesis of steroids, especially testosterone and P4 in active steroidogenic tissues [43]. Progesterone inhibits endometrial epithelial cell proliferation, adenogenesis and uterine gland development [44, 45]. A previous study showed that RB cows had higher concentrations of P4 receptor in the endometrium than non-RB cows, implying the existence of a local hormonal imbalance in RB cows [46]. In the present study, the GSTA3 was also highly expressed in the ICAR of RB cows compared with non-RB cows. In addition, immunohistochemistry revealed that a strong signal of GSTA3 protein was detected in the uterine luminal and glandular epithelium and stroma in RB cows. GSTA3 may also be involved in ICAR functions in RB cows by mediating steroidogenesis.

Gene ontology analysis using DAVID revealed that a number of biological processes and functions were different between RB and non-RB cows in both CAR and ICAR. In the CAR of RB cows, genes involved in development and morphogenesis were mainly up-regulated. These genes included 14 and 9 genes regulating embryo development and vasculature development, respectively. The CAR eventually attaches with the trophoblast to give rise to the maternal side of the placentome in pregnant animals [22, 23]. Up-regulation of the genes involved in embryo and vasculature development in the CAR may contribute to the success of implantation and following placental formation at the maternal-fetal interface. An increase in the regulation of these genes in the CAR may be one of the characteristics of the RB uterus. In the ICAR of both the ipsilateral and contralateral uterine horns, genes related to metabolic processes were predominantly enriched in both up- and down-regulated genes in RB cows compared with non-RB cows. The ICAR is a specific compartment containing the uterine glands, which synthesize and secrete various metabolites and histotroph required for estrous cyclicity or development of the conceptus [24]. Alterations of endometrial metabolic processes in RB cows may seriously affect maintenance of uterine function.

The DAVID analysis also revealed that the CAR of the ipsilateral uterine horn of RB cows is characterized by down-regulation of a number of genes associated with cytoskeleton organization, cell adhesion and cellular component organization compared with non-RB cows. Previous global gene expression studies in bovine endometrium showed that profiles of the genes assigned to these functional categories changes during estrous cycle and peri-implantation [1113], suggesting that these biological functions may be responsible for the regulation of uterine environment. Additionally, the endometrial cell adhesion molecules play a role in conceptus-endometrium attachment at implantation. A direct comparison of cyclic and pregnant endometrium found cell adhesion and cytoskeleton organization molecules affected by pregnancy in both CAR and ICAR [13]. Around the implantation period, the ipsilateral uterine horn is the site of first occurrence of conceptus-endometrial contact and modification of cytological character was seen exclusively on the CAR [47, 48]. Therefore, the lower expression of genes regulating cytoskeleton organization and cell adhesion in CAR of RB cows may be associated with inadequate endometrial responsiveness resulting in implantation failure.

CPXM2 was included in the top 10 down-regulated genes in both CAR and ICAR of the ipsilateral uterine horn. Previous microarray studies found no differences in CPXM2 expression in the bovine endometrium between highly fertile and poor fertile, and between highly fertile and subfertile cows at Day 14 of the estrous cycle [9], while expression decreasing at Day 7 compared to Day 3 of estrus in cows with low embryo receptivity [7]. CPXM2 is assumed to be more sensitive to P4 or some CL factors in a poorly fertile endometrium that includes the RB. Although the specific roles of CPXM2 remain unknown, DAVID analysis has assigned it belongs to the biological process of proteolysis and cell adhesion. Thus, CPXM2 may be related to alteration of endometrial cell adhesion in RB cows, as well as to the above described cell adhesion related genes that are down-regulated in the CAR of the ipsilateral uterine horn of RB cows.

KLHL24 (Kelch-like 24) was the only gene included in the top 10 up-regulated genes in all four endometrial compartments. A member of the KLHL family including KLHL24 is known to be involved in ubiquitination [49, 50]. It has been reported that lower expression of genes associated with ubiquitination in high fertile as compared with subfertile cows [9]. Although the specific roles of KLHL24 have not yet been elucidated, an increase in oxidative stress stimulated KLHL24 expression in human fibroblast cells [51], leading us to speculate that this gene is up-regulated to counteract cytoskeleton destruction by ROS- induced cell damage and/or to degrade proteins in cells exposed to ROS by ubiquitination reaction. Therefore, high expression of KLHL24 in RB cows compared with non-RB cows support the possibility that the endometrium of RB cows is under oxidative stress. However, it has been reported that the level of KLHL24 gene expression at Day 14 of the estrous cycle shows no significant difference among high fertile, low fertile and infertile cows [9]. The functional contribution of endometrial KLHL24 in bovine fertility remains unclear.

Analysis of the combined gene data sets of the four endometrial compartments revealed gene expression profiles of the whole uterus. PRSS2 and CHGA were the most pronounced up- and down-regulated genes, respectively. PRSS2 is a member of the trypsin family of serine proteases and degrades type I collagen directly or indirectly by activating several procollagenolytic matrix metalloproteinases (MMPs) [52, 53]. CHGA works as a pro-hormone for pancreastatin, vasostatin and catestatin [5456]. Full-length CHGA and vasostatin act as anti-angiogenic factors to inhibit two potent angiogenic factors, basic fibroblast growth factor (bFGF) and vascular endothelial growth factor, while CHGA cleaved by thrombin and catestatin promote angiogenesis by inducing the release of bFGF from vascular endothelial cells [57]. In the present study, we found that both PRSS2 and CHGA proteins were localized in the luminal and glandular epithelium and in the stroma of the endometrium. These localizations coincide with the tissue site of gelatinase activity of MMP-2 and the localization of MMPs and bFGF in the bovine endometrium [5860], suggesting paracrine and autocrine actions of PRSS2 and CHGA with MMPs and bFGF in the bovine endometrium. In addition, genes involved in cell death (DAPL1 and PRF1) or cell attachment (CD36, CDH1, CPXM2, KRT35 and THBS4) were also differentially expressed between RB and non-RB cows. Although further studies are needed to clarify, the endometrium of RB cows might not only be involved in the promotion of tissue remodeling and imbalance of angiogenesis but also in the degradation of cell renewal and tissue structure.

In cattle, around Day 15 of pregnancy is a stage of the beginning of conceptus elongation and maternal recognition of pregnancy [26]. A recent RNA-seq study identified numerous conceptus-expressed ligands that interact with corresponding receptors expressed on the endometrium and vice versa at Day 16 of pregnancy in cattle [61]. In the present study, some genes of endometrium expressed ligands (CCL4, CCL14, COL1A2, EDN1, F2, MMP2, THBS4 and TIMP3) and receptors (ACVR2B, BMPR2, CD4, CD36, IGF2R, IL10RB, KDR, TNFRSF25 and VLDLR) that interact with conceptus reported by Mamo et al. were differentially expressed between RB and non-RB cows. In addition, other genes encoding growth factors (FGF9 and GDF7) and cytokines (CCL8, CD14 and CD53) were down-regulated in the RB cows as compared with non-RB cows. Although the functional role of these two growth factors in bovine endometrium remains to be elucidated, FGF9 induces endometrial stromal cell proliferation [62]. Up-regulation of FGF9 and GDF7 expressions were detected in equine and/or swine pregnant endometrium and may be implicated in embryo-maternal communication at early pregnancy [63, 64]. The receptors of these growth factors were expressed in not only endometrium but also conceptus at Day 16 of pregnancy in cattle [61]. Therefore, alteration of the expression of these ligands and receptors in the RB cows may affect conceptus development and maternal recognition of pregnancy if a conceptus presents in the RB cows.

Conclusion

The results of the present study support the hypothesis that endometrial gene expression profiles are different between RB and non-RB cows. In RB cows, characteristic gene expression was identified in both the CAR and ICAR of both ipsilateral and contralateral uterine horns. The enriched GO terms of these genes were related to cell adhesion and morphogenesis in the CAR and metabolism in the ICAR. These results suggest that local regulation of molecular mechanisms in each endometrial compartment may contribute to normal uterine physiology. Therefore, the identified candidate endometrial genes and functions are likely to be involved in bovine reproductive performance. The present study could provide an information base for understanding underlying molecular pathogenesis and developing a treatment of repeat breeding in cattle from the point of view of endometrial function.

Abbreviations

ACVR2B: 

Activin A receptor type 2B

AI: 

Artificial insemination

bFGF: 

Basic fibroblast growth factor

BMPR2: 

Bone morphogenetic protein receptor type 2

CAR: 

Caruncular

CCL: 

Chemokine (C-C motif) ligand

CD4: 

CD4 molecule

CD14: 

CD14 molecule

CD36: 

CD36 molecule

CD53: 

CD53 molecule

CDH1: 

Cadherin 1, type 1

CHGA: 

Chromogranin A

CL: 

Corpus luteum

COL1A2: 

Collagen type I alpha 2 chain

CPXM2: 

Carboxypeptidase X (M14 family), member 2

DAPL1: 

Death associated protein-like 1

DAVID: 

Database for annotation, visualization and integrated discovery

DEG: 

Differentially expressed genes

EDN1: 

Endothelin 1

F2: 

Coagulation factor II, thrombin

FAM83D: 

Protein FAM83D

FGF9: 

Fibroblast growth factor 9

GDF7: 

Growth differentiation factor 7

GE: 

Glandular epithelium

GEO: 

Gene expression omnibus

GO: 

Gene ontology

GSTA3: 

Glutathione S-transferase A3

ICAR: 

Intercaruncular

IFIH1: 

Interferon induced with helicase C domain 1

IGF2R: 

Insulin like growth factor 2 receptor

IL10RB: 

Interleukin 10 receptor subunit beta

KDR: 

Kinase insert domain receptor

KLHL24: 

Kelch-like 24

KRT35: 

Keratin 35

LE: 

Luminal epithelium

LPLUNC1: 

Von Ebner minor salivary gland protein

MMP: 

Matrix metalloproteinase

P4: 

Progesterone

PIPOX: 

Pipecolic acid oxidase

PLEKHA5: 

Pleckstrin homology domain containing, family A member 5

PRF1: 

Perforin 1

PRSS2: 

Trypsin 2

qPCR: 

Quantitative real-time RT-PCR

RB: 

Repeat breeder

ROS: 

Reactive oxygen species

SLC39A2: 

Solute carrier family 39 (zinc transporter), member 2

SUZ12: 

Suppressor of zeste 12

THBS4: 

Thrombospondin 4

TIMP: 

Tissue inhibitor of metalloproteinase

TNFRSF25: 

Tumor necrosis factor receptor superfamily member 25

US: 

Uterine stroma

VLDLR: 

Very low density lipoprotein receptor

Declarations

Acknowledgement

The authors thank the staff of Livestock Research Support Center of the National Agriculture and Food Research Organization for animal management and their technical assistance for sample collection. This manuscript was proofread by a professional service (SciRevision, Kagawa, Japan) prior to submission.

Funding

This study was supported by a Grant-in-Aid for Research Program on Innovative Technologies for Animal Breeding, Reproduction, and Vaccine Development (REP1001) from the Ministry of Agriculture, Forestry and Fisheries of Japan.

Availability of data and materials

All microarray data are available at the Gene Expression Omnibus (GEO) database at NCBI (http://www.ncbi.nlm.nih.gov/geo), under accession numbers GSE79367. All datasets on which the conclusions of the paper rely are available to readers.

Authors’ contributions

KGH participated in the design of the study, collected the materials, carried out all experiments and drafted the manuscript. MH collected the materials and helped to carry out qPCR and immunohistochemistry. KK carried out microarray and microarray data analysis. KH and SF carried out immunohistochemistry. TT participated in the design of the study, collected the materials and carried out microarray experiments. RS supervised the study, collected the materials and helped to carry out all experiments. All authors read and approved the final manuscript.

Competing interests

The authors declare that they have no competing interests.

Consent for publication

Not applicable.

Ethics approval and consent to participate

All procedures in animal experiments were carried out in accordance with guidelines approved by the Animal Ethics Committee of the National Institute of Agrobiological Sciences for the use of animals (permission number: H18-036).

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Division of Animal Breeding and Reproduction Research, Institute of Livestock and Grassland Science, National Agriculture and Food Research Organization
(2)
Division of Animal Sciences, Institute of Agrobiological Sciences, National Agriculture and Food Research Organization
(3)
Cooperative Department of Veterinary Medicine, Faculty of Agriculture, Iwate University

References

  1. Perez-Marin CC, Calero GV, Moreno LM. Clinical Approach to the Repeat Breeder Cow Syndrome. In: Perez-Marin CC, editor. A Bird’s-Eye View of Veterinary Medicine. INTECH Open Access Publisher; 2012. doi:https://doi.org/10.5772/31374.
  2. Tanabe TY, Hawk HW, Hasler JF. Comparative fertility of normal and repeat-breeding cows as embryo recipients. Theriogenology. 1985;23:687–96.View ArticlePubMedGoogle Scholar
  3. Dochi O, Takahashi K, Hirai T, Hayakawa H, Tanisawa M, Yamamoto Y, Koyama H. The use of embryo transfer to produce pregnancies in repeat-breeding dairy cattle. Theriogenology. 2008;69:124–8.View ArticlePubMedGoogle Scholar
  4. Gustafsson H, Larsson K. Embryonic mortality in heifers after artificial insemination and embryo transfer: differences between virgin and repeat breeder heifers. Res Vet Sci. 1985;39:271–4.PubMedGoogle Scholar
  5. Albihn A, Gustafsson H, Rodriguez-Martinez H, Larsson K. Development of day 7 bovine demi-embryos transferred into virgin and repeat-breeder heifers. Anim Reprod Sci. 1989;21:161–76.View ArticleGoogle Scholar
  6. Katagiri S, Moriyoshi M. Alteration of the endometrial EGF profile as a potential mechanism connecting the alterations in the ovarian steroid hormone profile to embryonic loss in repeat breeders and high-producing cows. J Reprod Dev. 2013;59:415–20.View ArticlePubMedPubMed CentralGoogle Scholar
  7. Ponsuksili S, Murani E, Schwerin M, Schellander K, Tesfaye D, Wimmers K. Gene expression and DNA-methylation of bovine pretransfer endometrium depending on its receptivity after in vitro-produced embryo transfer. PLoS One. 2012;7:e42402.View ArticlePubMedPubMed CentralGoogle Scholar
  8. Walker CG, Littlejohn MD, Mitchell MD, Roche JR, Meier S. Endometrial gene expression during early pregnancy differs between fertile and subfertile dairy cow strains. Physiol Genomics. 2012;44:47–58.View ArticlePubMedGoogle Scholar
  9. Minten MA, Bilby TR, Bruno RG, Allen CC, Madsen CA, Wang Z, Sawyer JE, Tibary A, Neibergs HL, Geary TW, et al. Effects of fertility on gene expression and function of the bovine endometrium. PLoS One. 2013;8:e69444.View ArticlePubMedPubMed CentralGoogle Scholar
  10. Killeen AP, Morris DG, Kenny DA, Mullen MP, Diskin MG, Waters SM. Global gene expression in endometrium of high and low fertility heifers during the mid-luteal phase of the estrous cycle. BMC Genomics. 2014;15:234.View ArticlePubMedPubMed CentralGoogle Scholar
  11. Bauersachs S, Ulbrich SE, Gross K, Schmidt SE, Meyer HH, Einspanier R, Wenigerkind H, Vermehren M, Blum H, Sinowatz F, Wolf E. Gene expression profiling of bovine endometrium during the oestrous cycle: detection of molecular pathways involved in functional changes. J Mol Endocrinol. 2005;34:889–908.View ArticlePubMedGoogle Scholar
  12. Mitko K, Ulbrich SE, Wenigerkind H, Sinowatz F, Blum H, Wolf E, Bauersachs S. Dynamic changes in messenger RNA profiles of bovine endometrium during the oestrous cycle. Reproduction. 2008;135:225–40.View ArticlePubMedGoogle Scholar
  13. Mansouri-Attia N, Aubert J, Reinaud P, Giraud-Delville C, Taghouti G, Galio L, Everts RE, Degrelle S, Richard C, Hue I, et al. Gene expression profiles of bovine caruncular and intercaruncular endometrium at implantation. Physiol Genomics. 2009;39:14–27.View ArticlePubMedGoogle Scholar
  14. Forde N, Beltman ME, Duffy GB, Duffy P, Mehta JP, O’Gaora P, Roche JF, Lonergan P, Crowe MA. Changes in the endometrial transcriptome during the bovine estrous cycle: effect of low circulating progesterone and consequences for conceptus elongation. Biol Reprod. 2011;84:266–78.View ArticlePubMedGoogle Scholar
  15. Forde N, Carter F, Spencer TE, Bazer FW, Sandra O, Mansouri-Attia N, Okumu LA, McGettigan PA, Mehta JP, McBride R, et al. Conceptus-induced changes in the endometrial transcriptome: how soon does the cow know she is pregnant? Biol Reprod. 2011;85:144–56.View ArticlePubMedGoogle Scholar
  16. Bauersachs S, Ulbrich SE, Reichenbach HD, Reichenbach M, Buttner M, Meyer HH, Spencer TE, Minten M, Sax G, Winter G, Wolf E. Comparison of the effects of early pregnancy with human interferon, alpha 2 (IFNA2), on gene expression in bovine endometrium. Biol Reprod. 2012;86:46.View ArticlePubMedGoogle Scholar
  17. Forde N, Duffy GB, McGettigan PA, Browne JA, Mehta JP, Kelly AK, Mansouri-Attia N, Sandra O, Loftus BJ, Crowe MA, et al. Evidence for an early endometrial response to pregnancy in cattle: both dependent upon and independent of interferon tau. Physiol Genomics. 2012;44:799–810.View ArticlePubMedGoogle Scholar
  18. Spencer TE, Forde N, Dorniak P, Hansen TR, Romero JJ, Lonergan P. Conceptus-derived prostaglandins regulate gene expression in the endometrium prior to pregnancy recognition in ruminants. Reproduction. 2013;146:377–87.View ArticlePubMedPubMed CentralGoogle Scholar
  19. Shimizu T, Krebs S, Bauersachs S, Blum H, Wolf E, Miyamoto A. Actions and interactions of progesterone and estrogen on transcriptome profiles of the bovine endometrium. Physiol Genomics. 2010;42A:290–300.View ArticlePubMedGoogle Scholar
  20. Sakumoto R, Hayashi KG, Saito S, Kanahara H, Kizaki K, Iga K. Comparison of the global gene expression profiles in the bovine endometrium between summer and autumn. J Reprod Dev. 2015;61:297–303.View ArticlePubMedPubMed CentralGoogle Scholar
  21. King GJ, Atkinson BA, Robertson HA. Development of the bovine placentome during the second month of gestation. J Reprod Fertil. 1979;55:173–80.View ArticlePubMedGoogle Scholar
  22. King GJ, Atkinson BA, Robertson HA. Development of the bovine placentome from days 20 to 29 of gestation. J Reprod Fertil. 1980;59:95–100.View ArticlePubMedGoogle Scholar
  23. King GJ, Atkinson BA, Robertson HA. Development of the intercaruncular areas during early gestation and establishment of the bovine placenta. J Reprod Fertil. 1981;61:469–74.View ArticlePubMedGoogle Scholar
  24. Filant J, Spencer TE. Uterine glands: biological roles in conceptus implantation, uterine receptivity and decidualization. Int J Dev Biol. 2014;58:107–16.View ArticlePubMedPubMed CentralGoogle Scholar
  25. Pope WF, Maurer RR, Stormshak F. Distribution of progesterone in the uterus, broad ligament, and uterine arteries of beef cows. Anat Rec. 1982;203:245–50.View ArticlePubMedGoogle Scholar
  26. Ealy AD, Yang QE. Control of interferon-tau expression during early pregnancy in ruminants. Am J Reprod Immunol. 2009;61:95–106.View ArticlePubMedGoogle Scholar
  27. Dunne LD, Diskin MG, Sreenan JM. Embryo and foetal loss in beef heifers between day 14 of gestation and full term. Anim Reprod Sci. 2000;58:39–44.View ArticlePubMedGoogle Scholar
  28. Berg DK, van Leeuwen J, Beaumont S, Berg M, Pfeffer PL. Embryo loss in cattle between Days 7 and 16 of pregnancy. Theriogenology. 2010;73:250–60.View ArticlePubMedGoogle Scholar
  29. Kizaki K, Shichijo-Kizaki A, Furusawa T, Takahashi T, Hosoe M, Hashizume K. Differential neutrophil gene expression in early bovine pregnancy. Reprod Biol Endocrinol. 2013;11:6.View ArticlePubMedPubMed CentralGoogle Scholar
  30. da Huang W, Sherman BT, Lempicki RA. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc. 2009;4:44–57.View ArticleGoogle Scholar
  31. Ushizawa K, Takahashi T, Hosoe M, Ishiwata H, Kaneyama K, Kizaki K, Hashizume K. Global gene expression analysis and regulation of the principal genes expressed in bovine placenta in relation to the transcription factor AP-2 family. Reprod Biol Endocrinol. 2007;5:17.View ArticlePubMedPubMed CentralGoogle Scholar
  32. Walker CG, Meier S, Mitchell MD, Roche JR, Littlejohn M. Evaluation of real-time PCR endogenous control genes for analysis of gene expression in bovine endometrium. BMC Mol Biol. 2009;10:100.View ArticlePubMedPubMed CentralGoogle Scholar
  33. Ushizawa K, Takahashi T, Hosoe M, Kizaki K, Hashizume K. Characterization and expression analysis of SOLD1, a novel member of the retrotransposon-derived Ly-6 superfamily, in bovine placental villi. PLoS One. 2009;4:e5814.View ArticlePubMedPubMed CentralGoogle Scholar
  34. Hayes JD, McLellan LI. Glutathione and glutathione-dependent enzymes represent a co-ordinately regulated defence against oxidative stress. Free Radic Res. 1999;31:273–300.View ArticlePubMedGoogle Scholar
  35. Hayes JD, Flanagan JU, Jowsey IR. Glutathione transferases. Annu Rev Pharmacol Toxicol. 2005;45:51–88.View ArticlePubMedGoogle Scholar
  36. Ilic Z, Crawford D, Vakharia D, Egner PA, Sell S. Glutathione-S-transferase A3 knockout mice are sensitive to acute cytotoxic and genotoxic effects of aflatoxin B1. Toxicol Appl Pharmacol. 2010;242:241–6.View ArticlePubMedGoogle Scholar
  37. Kensler KH, Slocum SL, Chartoumpekis DV, Dolan PM, Johnson NM, Ilic Z, Crawford DR, Sell S, Groopman JD, Kensler TW, Egner PA. Genetic or pharmacologic activation of Nrf2 signaling fails to protect against aflatoxin genotoxicity in hypersensitive GSTA3 knockout mice. Toxicol Sci. 2014;139:293–300.View ArticlePubMedPubMed CentralGoogle Scholar
  38. Baranova H, Canis M, Ivaschenko T, Albuisson E, Bothorishvilli R, Baranov V, Malet P, Bruhat MA. Possible involvement of arylamine N-acetyltransferase 2, glutathione S-transferases M1 and T1 genes in the development of endometriosis. Mol Hum Reprod. 1999;5:636–41.View ArticlePubMedGoogle Scholar
  39. Jackson LW, Schisterman EF, Dey-Rao R, Browne R, Armstrong D. Oxidative stress and endometriosis. Hum Reprod. 2005;20:2014–20.View ArticlePubMedGoogle Scholar
  40. Yokoi R, Hayashi M, Tamura T, Kobayashi K, Kuroda J, Kusama H, Kagami H, Ono T. Embryonic mortality and intrauterine growth retardation (IUGR) associated with placental alterations in pregnant rats treated with methyl methanesulfonate (MMS) at the peri-implantation stage. J Toxicol Sci. 2008;33:585–98.View ArticlePubMedGoogle Scholar
  41. Celi P, Merlo M, Da Dalt L, Stefani A, Barbato O, Gabai G. Relationship between late embryonic mortality and the increase in plasma advanced oxidised protein products (AOPP) in dairy cows. Reprod Fertil Dev. 2011;23:527–33.View ArticlePubMedGoogle Scholar
  42. Loset M, Mundal SB, Johnson MP, Fenstad MH, Freed KA, Lian IA, Eide IP, Bjorge L, Blangero J, Moses EK, Austgulen R. A transcriptional profile of the decidua in preeclampsia. Am J Obstet Gynecol. 2011;204:84. e81-27.View ArticlePubMedPubMed CentralGoogle Scholar
  43. Johansson AS, Mannervik B. Human glutathione transferase A3-3, a highly efficient catalyst of double-bond isomerization in the biosynthetic pathway of steroid hormones. J Biol Chem. 2001;276:33061–5.View ArticlePubMedGoogle Scholar
  44. Gray CA, Bazer FW, Spencer TE. Effects of neonatal progestin exposure on female reproductive tract structure and function in the adult ewe. Biol Reprod. 2001;64:797–804.View ArticlePubMedGoogle Scholar
  45. Filant J, Zhou H, Spencer TE. Progesterone inhibits uterine gland development in the neonatal mouse uterus. Biol Reprod. 2012;86:146. 141–149.View ArticlePubMedPubMed CentralGoogle Scholar
  46. Almeida Fo AP, Ayalon N, Bartoov B. Progesterone receptors in the endometrium of normal and repeat-breeder cows. Anim Reprod Sci. 1987;14:11–9.View ArticleGoogle Scholar
  47. Boshier DP. A histological and histochemical examination of implantation and early placentome formation in sheep. J Reprod Fertil. 1969;19:51–61.View ArticlePubMedGoogle Scholar
  48. Spencer TE, Johnson GA, Bazer FW, Burghardt RC. Fetal-maternal interactions during the establishment of pregnancy in ruminants. Soc Reprod Fertil Suppl. 2007;64:379–96.PubMedGoogle Scholar
  49. Dhanoa BS, Cogliati T, Satish AG, Bruford EA, Friedman JS. Update on the Kelch-like (KLHL) gene family. Hum Genomics. 2013;7:13.View ArticlePubMedPubMed CentralGoogle Scholar
  50. Lin Z, Li S, Feng C, Yang S, Wang H, Ma D, Zhang J, Gou M, Bu D, Zhang T, et al. Stabilizing mutations of KLHL24 ubiquitin ligase cause loss of keratin 14 and human skin fragility. Nat Genet. 2016;48:1508–16.View ArticlePubMedGoogle Scholar
  51. Schweikl H, Hiller KA, Eckhardt A, Bolay C, Spagnuolo G, Stempfl T, Schmalz G. Differential gene expression involved in oxidative stress response caused by triethylene glycol dimethacrylate. Biomaterials. 2008;29:1377–87.View ArticlePubMedGoogle Scholar
  52. Sorsa T, Salo T, Koivunen E, Tyynela J, Konttinen YT, Bergmann U, Tuuttila A, Niemi E, Teronen O, Heikkila P, et al. Activation of type IV procollagenases by human tumor-associated trypsin-2. J Biol Chem. 1997;272:21067–74.View ArticlePubMedGoogle Scholar
  53. Moilanen M, Sorsa T, Stenman M, Nyberg P, Lindy O, Vesterinen J, Paju A, Konttinen YT, Stenman UH, Salo T. Tumor-associated trypsinogen-2 (trypsinogen-2) activates procollagenases (MMP-1, −8, −13) and stromelysin-1 (MMP-3) and degrades type I collagen. Biochemistry. 2003;42:5414–20.View ArticlePubMedGoogle Scholar
  54. Tatemoto K, Efendic S, Mutt V, Makk G, Feistner GJ, Barchas JD. Pancreastatin, a novel pancreatic peptide that inhibits insulin secretion. Nature. 1986;324:476–8.View ArticlePubMedGoogle Scholar
  55. Aardal S, Helle KB, Elsayed S, Reed RK, Serck-Hanssen G. Vasostatins, comprising the N-terminal domain of chromogranin A, suppress tension in isolated human blood vessel segments. J Neuroendocrinol. 1993;5:405–12.View ArticlePubMedGoogle Scholar
  56. Mahata SK, O’Connor DT, Mahata M, Yoo SH, Taupenot L, Wu H, Gill BM, Parmer RJ. Novel autocrine feedback control of catecholamine release. A discrete chromogranin a fragment is a noncompetitive nicotinic cholinergic antagonist. J Clin Invest. 1997;100:1623–33.View ArticlePubMedPubMed CentralGoogle Scholar
  57. Helle KB, Corti A. Chromogranin A: a paradoxical player in angiogenesis and vascular biology. Cell Mol Life Sci. 2015;72:339–48.View ArticlePubMedGoogle Scholar
  58. Michael DD, Alvarez IM, Ocon OM, Powell AM, Talbot NC, Johnson SE, Ealy AD. Fibroblast growth factor-2 is expressed by the bovine uterus and stimulates interferon-tau production in bovine trophectoderm. Endocrinology. 2006;147:3571–9.View ArticlePubMedGoogle Scholar
  59. Kizaki K, Ushizawa K, Takahashi T, Yamada O, Todoroki J, Sato T, Ito A, Hashizume K. Gelatinase (MMP-2 and −9) expression profiles during gestation in the bovine endometrium. Reprod Biol Endocrinol. 2008;6:66.View ArticlePubMedPubMed CentralGoogle Scholar
  60. Ulbrich SE, Meyer SU, Zitta K, Hiendleder S, Sinowatz F, Bauersachs S, Buttner M, Frohlich T, Arnold GJ, Reichenbach HD, et al. Bovine endometrial metallopeptidases MMP14 and MMP2 and the metallopeptidase inhibitor TIMP2 participate in maternal preparation of pregnancy. Mol Cell Endocrinol. 2011;332:48–57.View ArticlePubMedGoogle Scholar
  61. Mamo S, Mehta JP, Forde N, McGettigan P, Lonergan P. Conceptus-endometrium crosstalk during maternal recognition of pregnancy in cattle. Biol Reprod. 2012;87:6. 1–9.View ArticlePubMedGoogle Scholar
  62. Tsai SJ, Wu MH, Chen HM, Chuang PC, Wing LY. Fibroblast growth factor-9 is an endometrial stromal growth factor. Endocrinology. 2002;143:2715–21.View ArticleGoogle Scholar
  63. Ostrup E, Bauersachs S, Blum H, Wolf E, Hyttel P. Differential endometrial gene expression in pregnant and nonpregnant sows. Biol Reprod. 2010;83:277–85.View ArticlePubMedGoogle Scholar
  64. Klein C. Novel equine conceptus-endometrial interactions on day 16 of pregnancy based on RNA sequencing. Reprod Fertil Dev. 2016;28:1712–20.View ArticleGoogle Scholar

Copyright

© The Author(s). 2017

Advertisement