Skip to content

Advertisement

  • Erratum
  • Open Access

Erratum to: Evidence of inhibin/activin subunit betaC and betaE synthesis in normal human endometrial tissue

  • 1, 2Email author,
  • 1, 2,
  • 1, 2,
  • 1, 2 and
  • 1, 2
Reproductive Biology and Endocrinology20119:1

https://doi.org/10.1186/1477-7827-9-1

  • Received: 22 December 2010
  • Accepted: 5 January 2011
  • Published:

The original article was published in Reproductive Biology and Endocrinology 2010 8:143

Correction

We have previously demonstrated the expression of inhibin subunits in endometrial tissues and used β-actin primer pairs to perform a PCR analysis loading control [1]. However, instead of using the mentioned β-actin primer pairs from a commercial molecular biology supplier, we used the β-actin primer pair listed in Table 1. All depicted primer pairs in Table 1 were designed and established by our group, and synthesized by the supplier Biomers.net (Ulm, Germany).
Table 1

Primer sequences and length of amplification products

 

Forward primer (5' - 3')

Backward primer (5' - 3')

Length

Inhibin-α

CCGGCCATCCCAGCATACACGC

GAGTTGAGCGTCGGGCTCTC

359 bp

Inhibin-βA

TGCCCTTGCTTTGGCTGAGA

ACTTTGCCCACATGAAGCTTT

282 bp

Inhibin-βB

GGCGAGCGGCGACTCAACCTAGA

CGTGTGGAAGGAGGAGGCAGAGC

333 bp

Inhibin-βC

GCAGCCCGGGTGAGAGTTGG

ACTGCACCCACAGGCCTC

393 bp

Inhibin-βE

AGCCCTTCCTAGAGCTTAAG

GCTGCAGCCACAGGCC

404 bp

β-actin

GGAGAAGCTGTGCTACGTCG

CGCTCAGGAGGAGCAATGAT

366 bp

bp = base pairs

Notes

Authors’ Affiliations

(1)
Ludwig-Maximilians-University Munich, 1st Department of Obstetrics and Gynecology, Maistrasse 11, 80337 Munich,, Germany
(2)
Department of Obstetrics and Gynecology, Klinikum Neuperlach, Munich, Germany

References

  1. Mylonas I, Brüning A, Shabani N, Kunze S, Kupka MS: Evidence of inhibin/activin subunit betaC and betaE synthesis in normal human endometrial tissue. Reprod Biol Endocrinol. 2010, 19 (8): 143-10.1186/1477-7827-8-143.View ArticleGoogle Scholar

Copyright

Advertisement