Skip to main content

Advertisement

Table 1 Primer sequences and length of amplification products

From: Erratum to: Evidence of inhibin/activin subunit betaC and betaE synthesis in normal human endometrial tissue

  Forward primer (5' - 3') Backward primer (5' - 3') Length
Inhibin-α CCGGCCATCCCAGCATACACGC GAGTTGAGCGTCGGGCTCTC 359 bp
Inhibin-βA TGCCCTTGCTTTGGCTGAGA ACTTTGCCCACATGAAGCTTT 282 bp
Inhibin-βB GGCGAGCGGCGACTCAACCTAGA CGTGTGGAAGGAGGAGGCAGAGC 333 bp
Inhibin-βC GCAGCCCGGGTGAGAGTTGG ACTGCACCCACAGGCCTC 393 bp
Inhibin-βE AGCCCTTCCTAGAGCTTAAG GCTGCAGCCACAGGCC 404 bp
β-actin GGAGAAGCTGTGCTACGTCG CGCTCAGGAGGAGCAATGAT 366 bp
  1. bp = base pairs