Skip to main content

Table 1 Primer pairs and corresponding annealing temperatures used in this study

From: Icariin improves testicular dysfunction via enhancing proliferation and inhibiting mitochondria-dependent apoptosis pathway in high-fat diet and streptozotocin-induced diabetic rats

Gene Sequence(5′-3′) Annealing Temperature Product (bp)
PCNA F: GCTCCATCCTGAAGAAGGT
R: TGCACTAAGGAGACGTGAGA
55 °C 121
Bax F:GAGACACCTGAGCTGACCTT 55 °C 104
R:TCCATGTTGTTGTCCAGTTC
Bcl-2 F:AGTACCTGAACCGGCATCT 55 °C 120
R:TCTTCAGAGACAGCCAGGA
Caspase-3 F:CCGGTTACTATTCCTGGAGA 55 °C 117
R:TAACACGAGTGAGGATGTGC
SIRT1 F:GTGGCAGTAACAGTGACAGTG
R:GTCAGCTCCAGATCCTCCAG
55 °C 143
HIF1α F:GATGGAATGGAGCAGAAGAC
R: CACAATCGTAACTGGTCAGC
55 °C 112
CAT F: ACAACTCCCAGAAGCCTAAGAATG
R: RGCTTTTCCCTTGGCAGCTATG
55 °C 76
Gpx F: GGAGAATGGCAAGAATGAAGA
R: RCCGCAGGAAGGTAAAGAG
55 °C 139
SOD F: CGAGCATGGGTTCCATGTC
R: CTGGACCGCCATGTTTCTTAG
55 °C 101
GAPDH F: CCTCAAGATTGTCAGCAATG
R: CAGTCTTCTGAGTGGCAGTG
55 °C 134