Fig. 2

Summary of PGT-SR results of the couple. a NGS analysis of three trophectoderm biopsy sample. Embryo 1 and embryo 2 were detected as balanced; Embryo 3 was unbalanced. b Diagnosis of the carrier status of embryo 1 and embryo 2. Breakpoint-specific PCR were amplified using the primers WB1-F/R (F: ATTTCTTGGGTGCCCCTCTG, R: AGCATTCTTTCTCACTCATCCCA), WB2-F/R (F: GGGAAATTAGGCAACCCCAAG, R: GAGAGTCTCGCCCAAAGTCA), HB1-F/R (F: CCAATCCGACTGGTTGTGGG, R: TGTGCATGTTAAGCCCACTCT) and HB2-F/R (F: AAGTACACTCCACAGAGTGGG, R: CAGGGAGAGGCAACTTCTCAA); PCR Agarose gel showing the presence (+) or absence (−) of a PCR product for breakpoint or normal sequence; the DNA of the wife and the hasband were uesd for carrier DNA positive controls; a normal DNA was uesd for noncarrier DNA positive control; M = DNA marker; WB1 = wife breakpoint 1; WB2 = wife breakpoint 2; HB1 = husband breakpoint 1; HB2 = husband breakpoint 2. c Karyotype of the fetus: 46,XY,t(10;16)(q25.2;q12.1)mat. d SNP-based CMA of the fetus