Skip to main content

Table 2 Primers used for qRT-PCR

From: Downregulation of TTF1 in the rat hypothalamic ARC or AVPV nucleus inhibits Kiss1 and GnRH expression, leading to puberty delay

Gene Forward primers(5′-3′) Reverse primers(5′-3′)
Kiss1 (Rat) AGCTGCTGCTTCTCCTCTGT AGGCTTGCTCTCTGCATACC
TTF1 (Rat) GGACGTGAGCAAGAACATGG GCCGACAGGTACTTCTGCTG
GnRH (Rat) CCGCTGTTGTTCTGTTGACTGTG GGGGTTCTGCCATTTGATCCTC
β-actin (Rat) TGCCGCATCCTCTTCCT GGTCTTTACGGATGTCAACG
TTF1 (mouse) GGGCCAGGTCTCTAGCCTATC CTCACCAGGTCCGACCATAAA
Kiss1 (mouse) CTCTGTGTCGCCACCTATGG AGGCTTGCTCTCTGCATACC
GnRH (mouse) TGATCCTCAAACTGATGGCCG CGCAACCCATAGGACCAGTG
β-actin (mouse) AAGATCAAGATCATTGCTCCTCC GACTCATCGTACTCCTGCTTGC