Skip to main content

Table 1 Primers used for quantitative PCR

From: Identification of key pathways and genes in polycystic ovary syndrome via integrated bioinformatics analysis and prediction of small therapeutic molecules

Primer sequence (5'→3')
Gene Forward Reverse
SAA1 TCGTTCCTTGGCGAGGCTTTTG AGGTCCCCTTTTGGCAGCATCA
ADCY6 CTCCTGGTCCCTAAAGTGGAT GGAGGCAGCTCATATAGCGG
POLR2K GGAGAGTGTCACACAGAAAATGA TCGAGCATCAAAAACGACCAAT
RPS15 CCCGAGATGATCGGCCACTA CCATGCTTTACGGGCTTGTAG
RPS15A CTCCAAAGTCATCGTCCGGTT TGAGTTGCACGTCAAATCTGG
CTNND1 GTGACAACACGGACAGTACAG TTCTTGCGGAAATCACGACCC
ESR1 CCCACTCAACAGCGTGTCTC CGTCGATTATCTGAATTTGGCCT
NEDD4L GACATGGAGCATGGATGGGAA GTTCGGCCTAAATTGTCCACT
KNTC1 ACCTGAGTGTCGGTTCAAGAA CACTGATTGGTCGGCTACAATAA
NGFR CCTACGGCTACTACCAGGATG CACACGGTGTTCTGCTTGT
\