Skip to main content

Table 1 Primers for real time PCR

From: Sphingosine 1-phosphate protects against radiation-induced ovarian injury in female rats—impact on mitochondrial-related genes

Gene Types of primers Gene sequence
Uqcrh Forward TTTGACTTCCTGCATGCACG
Reverse CAAGCTGTTCCGATTCCCAG
Micu2 Forward TGTGCTTTCTGGAGGGCTAA
Reverse CTACTCCCTAGGCCACCATG
Gpx4 Forward TAAGTACAGGGGTTGCGTGT
Reverse AGGCCAGGATTCGTAAACCA
ACTB (internal reference) Forward AAGTCCCTCACCCTCCCAAAAG
Reverse AAGCAATGCTGTCACCTTCCC
  1. PCR Polymerase chain reaction