Skip to main content

Table 1 The primer sequences of the RT-qPCR tested genes

From: Decreased brain and muscle ARNT-like protein 1 expression mediated the contribution of hyperandrogenism to insulin resistance in polycystic ovary syndrome

GenePrimer forward (5′ to 3′)Primer reverse (5′ to 3′)
Bmal1 (rat)GGCTGTTCAGCACATGAAAACGCTGCCCTGAGAATTAGGTGTT
Clock (rat)CTTCCTGGTAACGCGAGAAAGGTCGAATCTCACTAGCATCTGAC
Per1 (rat)GATGTGGGTGTCTTCTATGGCAGGACCTCCTCTGATTCGGC
Per2 (rat)CAGGTTGAGGGCATTACCTCCAGGCGTCCTTCTTACAGTGAA
Cry1 (rat)CACTGGTTCCGAAAGGGACTCCTGAAGCAAAAATCGCCACCT
Cry2 (rat)CACTGGTTCCGCAAAGGACTACCACGGGTCGAGGATGTAGA
Sirt1 (rat)TGATTGGCACCGATCCTCGCCACAGCGTCATATCATCCAG
Nampt (rat)CCTGGTATCCAATTACAGTGGCCCAAATGAGCAGATGCCCCTAT
Glut4 (rat)ACACTGGTCCTAGCTGTATTCTCCAGCCACGTTGCATTGTA
Pparg (rat)GGAAGACCACTCGCATTCCTTGTAATCAGCAACCATTGGGTCA
β-Actin (rat)GGCCAACCGTGAAAAGATGACCAACCCTCATAGATGGGCACAG
Bmal1 (mouse)ACAGTCAGATTGAAAAGAGGCGGCCATCCTTAGCACGGTGAG
Clock (mouse)ATGGTGTTTACCGTAAGCTGTAGCTCGCGTTACCAGGAAGCAT
Per1 (mouse)GAATTGGAGCATATCACATCCGACCCGAAACACATCCCGTTTG
Per2 (mouse)CTCCAGCGGAAACGAGAACTGTTGGCAGACTGCTCACTACTG
Sirt1 (mouse)ATGACGCTGTGGCAGATTGTTCCGCAAGGCGAGCATAGAT
Nampt (mouse)GCAGAAGCCGAGTTCAACATCTTTTCACGGCATTCAAAGTAGGA
Glut4 (mouse)GGACCGGATTCCATCCCACTCCCAACCATTGAGAAATGATGC
Pparg (mouse)CTCCAAGAATACCAAAGTGCGAGCCTGATGCTTTATCCCCACA
β-Actin (mouse)GTGACGTTGACATCCGTAAAGAGCCGGACTCATCGTACTCC