Skip to main content

Table 1 Primer Sequences used for qPCR

From: Ovulatory signals alter granulosa cell behavior through YAP1 signaling

Gene SymbolForwardReverse
Yap1ATCCCTGATGATGTACCACTGCCACAGGAACGTTCAGTTGCGAAAGCA
Wwtr1 (Taz)CAAGCCTGCATTTCTGTGGCAGATTCACTGCCTGAGGTCAGCTTTGTA
Lats1GAATGAGCCCGTGAAAGCAACACATTCAGACTTCAGACGCTCCATGCT
Lats2TGAAGAGGGCCAAGATGGACAAGTAGAGCGTGAGTGTCCAGCTTACAA
Stk4 (Mst1)CAGGGCCTGCATAACATTTGCTGTTTCCTTGTCTGGCAAAGCCCAAAG
Stk3 (Mst2)AAGAGACCTGATCGCAGAAGCCATCATTGTGCCCACGCTTTCTGAACT
Mob1bTTGACAGCAGACTTACCACTCCGTACACACACACACACGTCTCCTCAT
Sav1TGGTCCCTGCAAATCCCTACCATAACTTCAGCATTCCCTGGTACGTGT
RPL19TTCAAAAACAAGCGCATCCTCTTTCGTGCTTCCTTGGTCT
  1. All sequences are from 5′ to 3′