Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 List of oligonucleotide primer sequences

From: Possible involvement of the RARRES2/CMKLR1-system in metabolic and reproductive parameters in Holstein dairy cows

Gene name Forward 5′–3′ Reverse 5′–3′ Size (bp) Accession number PCR efficiency
UXT CATTGAGCGACTCCAGGAAG GGCCACATAGATCCGTGAAG 111 NM 001037471.2 2.01
SDHA TATATGGCGCTGGCTGTCTC CCTCTTCCCTCGCGGATTTC 168 XR 003031167.1 1.95
PPIA GCATACAGGTCCTGGCATCT TGTCCACAGTCAGCAATGGT 216 NM 178320 2.00
RARRES2 GAGGAGTTCCACAAGCATC ACCTGAGTCTGTATGGGACA 265 XM 024990576.1 1.90
CMKLR1 CGGCCATGTGCAAGATCAGC CAGGCTGAAGTTGTTAAAGC 259 XM 005218095.3 2.00
  1. UXT Ubiquitously expressed transcript protein, SDHA Succinate dehydrogenase complex, subunit A, PPIA Peptidylpropyl isomerase A, RARRES2 Retinoic acid receptor responder 2, CMKLR1 Chemokine like receptor 1