Skip to main content

Table 1 The primer sequences used for Real-time RT-PCR

From: miR-34c disrupts spermatogonial stem cell homeostasis in cryptorchid testes by targeting Nanos2

Gene Species Forward Reverse
Nanos2 Mouse CCATATGCAACTTCTGCAA ACTGCTGACTGCTGTTGAGTG
Nanos2 Human CTGAGAAGTGCCTACTCAAG TGATACGGTGCTCTCCAGAG
miR-34c Human/Mouse CACGCAAGGCAGTGTAGT CCAGTGCAGGGTCCGAGGTA
18S Human/Mouse CGGCGACGACCCATTCGAAC GAATCGAACCCTGATTCCCCGTC