Skip to main content

Advertisement

Table 1 Primer sequences of PCR

From: Effects of Levonorgestrel and progesterone on Oviductal physiology in mammals

Gene Forward primer Reverse primer
18 s GTAACCCGTTGAACCCCATT CCATCCAATCGGTAGTAGCG
STAT3 CAGTGACAGCTTCCCAATGG ACTGCTGGTCAATCTCTCCC
IGFBP1 TGATGGCCCCTTCTGAAGAG TCTCCTGTGCCTTGGCTAAA
ITGB3 TGACGAAAATACCTGCAACCG GCATCCTTGCCAGTGTCCTTAA
MUC1 GAAAGAACTACGGGCAGCTG GCCACCATTACCTGCAGAAA
LIF TGAACCAGATCAGGAGCCAA GACTATGCGGTACAGCTCCA
ACVR1B AAAGACAAGACGCTCCAGGA ATACTTCCCCAAACCGACCC