Skip to main content

Table 1 Primer pairs specific for each gene used in the study

From: Deficiency of Gpr1 improves steroid hormone abnormality in hyperandrogenized mice

Name Fw Primer Sequence (5′-3′) Rv Primer Sequence (5′-3′) Target Sequence
GnRH gtggatcaaatggcagaaccc gggccagtgcatctacatct NM_008145.3
AR tccaagacctatcgaggagcg gtgggcttgaggagaaccat NM_013476.4
ERA cccgccttctacaggtctaat ctttctcgttactgctggacag NM_007956.5
LH tggccgcagagaatgagttc ctcggaccatgctaggacagtag NM_008497.2
FSH ggagagcaatctgctgccata gcagaaacggcactcttcct NM_008045.3
GH ctacaaagagttcgagcgtgcctac caattccatgtcggttctctgc NM_008117.3
PRL agggagttgagaagataattagccag aagaggagaccaattgcaccca NM_011164.2
UCP1 actgccacacctccagtcatt ctttgcctcactcaggattgg NM_009463.3
StAR ccgggtggatgggtcaa cacctctccctgctggatgta NM_011485.4
P450scc ccatcagatgcagagtttccaa tgagaagagtatcgacgcatcct NM_019779.3
3B-HSD ggaggcctgtgttcaagcaa ggccctgcaacatcaactg NM_008293.4
17B-HSD ttgtttgggccgctagaag cacccacagcgttcaattca NM_010475.1
Aromatase gcaatcctgaaggagatcca gccgtcaattacgtcatcct NM_007810.3
Hsd17b7 cctgtgctcagtccgttttt ccaaggccctgaattcaata NM_010476.3
  1. Supplement: Internal Reference βactin Fw,gtgacgttgacatccgtaaaga Rv,gccggactcatcgtactccTarget,NM_007393.5