Skip to main content

Advertisement

Table 1 Primers used in the study

From: Intracerebroventricular injection of RFRP-3 delays puberty onset and stimulates growth hormone secretion in female rats

Gene Sequence (5′ to 3′) Product size
GAPDH-F ACTTTGGCATCGTGGAAGGG 128 bp
GAPDH-R TGCAGGGATGATGTTCTGGG
Kiss1-F GGTATGCAGAGAGCAAGCCT 122 bp
Kiss1-R GATCAGGCGACTGCGGG
GnRH-F CACTGGTCCTATGGGTTGCG 149 bp
GnRH-R TCCCTAAGAGGTGAACGGGG