Skip to main content

Table 1 Oligonucleotide sequences used for RT-PCR analysis

From: Effects of platelet-rich plasma in a model of bovine endometrial inflammation in vitro

Marker Forward 5'-3' Reverse 5'-3' T annealing bp
Interleukin-1β
(IL-1β)
TGCAGCTGGAGGAAGTAGAC GTCGGGCATGGATCAGACAA 60 338
Interleukin 8
(IL-8)
ACATACCCTGCCACAAGGC TGGGGACTGCTCTTCCCTCT 57 146
Inducible nitric oxide synthase (iNOS) GGACCTCAACAAAGCCCTGA CCTTGACCCAATAGCTGCCA 60 293
Prostaglandin-endoperoxide synthase 2
(COX2)
CATGGGTGTGAAAGGGAGGAA AAAGACGTCAGGCAGAAGGG 60 700
Tumor protein p53
(TP53)
CCTAGGAGCACTAAGCGAGC GCCCCTCTCTCTTGAGCATT 55 268
Oestrogen receptor alpha
(ERα)
AGGGAAGCTCCTATTTGCTCC CGGTGGATGTGGTCCTTCTCT 55 234
Oestrogen receptor beta
(ERβ)
GCTTCGTGGAGCTCAGCCTG AGGATCATGGCCTTGACACAG 55 262
Progesterone receptor
(PR)
GAGAGCTCATCAAGGCAATTGG CACCATCCCTGCCAATATCTTG 55 227
v-myc avian myelocytomatosis viral oncogene homolog
(c-Myc)
GCGCCGCATTCGCGAAACTT TGAGGGGCATCGCTGCAAGC 58 °C 214
Glyceraldehyde-3-phosphate dehydrogenase
(GAPDH)
ATGAGATCAAGAAGGTGGTG CCAAATTCATTGTCGTACCAG 60 190