Skip to main content

Table 1 Sequences of primers used for real-time PCR analysis

From: MicroRNA-132 promotes estradiol synthesis in ovarian granulosa cells via translational repression of Nurr1

Gene Forward primer (5' → 3') Reverse primer (5' → 3')
miR-132 ACACTCCAGCTGGGTAACAGTCTACAGCCA GGTGTCGTGGAGTCGGCAATTCAGTTGAG
U6 snRNA CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT
Cyp19a1 TGTGTTGACCCTCATGAGACA CTTGACGGATCGTTCATACTTTC
Cyp11a1 TCCCTGTAAATGGGGCCATAC AGGTCCTTCAATGAGATCCCTT
Nurr1 GATCGAGCAGAGGAAGAC AAGCGCATCTGGCAGCTA
18S rRNA ATGGCCGTTCTTAGTTGGTG CGGACATCTAAGGGCATCAC