Skip to main content

Table 1 Primers used for the qPCR experiments for 6 RAS genes

From: The rat placental renin-angiotensin system - a gestational gene expression study

Gene Forward (5’-3’) Reverse (5’-3’)
Ace ATTGCAGCCGGGCAACTTTT CGCATTCTCCTCCGTGATGT
Ace2 GAGCCCATATGCCGACCAAA TCTGCCTCCCCAAAAGGAAC
Mme CCGAAATGACCCAATGCTGC TGACCAGCTGAATGGCTTCC
Thop1 ATGCTGGAGAACTGGGTGTG GAAGAGACCTGCATTGGCCT
Anpep AGATTGCCCTGCCTGACTTC GTTGCCAAACCACTGATGGG
Agtr1a GGATTCGTGGCTTGAGTCCT TCGAAATCCACTTGACCTGGTG