Skip to main content

Table 1 Primers used for real-time PCR

From: The effect of lysophosphatidic acid during in vitro maturation of bovine cumulus–oocyte complexes: cumulus expansion, glucose metabolism and expression of genes involved in the ovulatory cascade, oocyte and blastocyst competence

Gene Primer sequence (5′–3′) Fragment size, bp GenBank accession no.
OCT4 GAGAAAGACGTGGTCCGAGTG 101 NM_174580.2
GACCCAGCAGCCTCAAAATC
SOX2 TGGATCGGCCAGAAGAGGAG 89 NM_001105463.2
CAGGCGAAGAATAATTTGGGGG
IGF1R GAGTGGAGAAATCTGCGGG 110 NM_001244612.1
AAATGAGCAGGATGTGGAGGT
IGF2R ACCTCCGATCCTCAATCCCA 82 NM_174352.2
TGTAGTTGAAGTGCCGGTCC
PLAC8 TTTACCGCTCTGTGCCCTTT 95 NM_001025325.2
CCATGTGAACTTGACCAAGCAT
BCL2 GAGTTCGGAGGGGTCATGTG 203 NM_001166486.1
GCCTTCAGAGACAGCCAGGA
BAX GTGCCCGAGTTGATCAGGAC 126 NM_173894.1
CCATGTGGGTGTCCCAAAGT
AREG CTTTCGTCTCTGCCATGACCTT 100 NM_001099092.1
CGTTCTTCAGCGACACCTTCA
EREG TCACCGCGAGAAGGATGGAG 73 XM_002688367.3
GTACTGAAGACCAGGACGAGC
BTC GCCCCAAGCAGTACAAGCAT 100 NM_173896.2|
GCCCCAGCATAGCCTTCATC
EGFR AAAGTTTGCCAAGGGACAAG 253 XM_002696890.2
AAAGCACATTTCCTCGGATG
ADAM10 GCTGGGAGGTCAGTATGGAA 105 NM_174496.2
CTTTTGGCACGCTGGTGTTT
ADAM17 TGTTCCACCCCAGTAACGTC 73 XM_002691486.3
GGAAAGGGCTTGATGATGCG
HAS2 CGGGGGAGATGTCCAGATTTT 120 NM_174079.2
TGGACACATCCGAAATAAGACTG
PTX3 GCCGGCAGGTTGTGAAACA 93 NM_001076259.2
GTCTCGAGTTTCATTGGTGTCA
TNFAIP6 TGCTACAACCCACATGCAAA 83 NM_001007813.2
TCATTTGGGAAGCCTGGAGA
PTGS2 TGGGTGTGAAAGGGAGGAAA 127 NM_174445.2
AAGTGCTGGGCAAAGAATGC
GFPT1 AAACACAGTCGGCAGTTCCA 80 NM_001109961.1
TGGCTACACCAATCTCAGGC
GFPT2 GAGATGTGCGGAATCTTTGCC 120 NM_001076883.1
ACCTGCTGAGTCATAGCCTCT
GLUT1 GATCCACAGAGCGCAGCC 90 NM_174602.2
TGTCAGCTTCTTGCTGGTGG
GLUT4 ATTGTGGCCATCTTTGGCTTCGTG 160 NM_174604.1
AACCCATGCCGATGATGAAGTTGC
LDHA TCTGGATTCAGCTCGCTTCCGTTA 147 NM_174099.2
TTCTTCAGGGAGACACCAGCAACA
PFKP TCAGAGAACCGTGCCTGGAAGAAA 112 NM_001193220.1
TGACCACAAGCTCCTTGATCTGCT
GAPDH CACCCTCAAGATTGTCAGCA 103 NM_001034034.2
GGTCATAAGTCCCTCCACGA