Skip to main content

Table 1 Primer sequences for various transcripts used in the study

From: Chemoablated mouse seminiferous tubular cells enriched for very small embryonic-like stem cells undergo spontaneous spermatogenesis in vitro

Primer Sequence Annealing temperature
Sca-1   
F AGAGGAAGTTTTATCTGTGCAGCCC 66°C
R TCCACAATAACTGCTGCCTCCTGA  
Gfra   
F GGCCTACTCGGGACTGATTGG 58°C
R GGGAGGAGCAGCCATTGATTT  
Prohibitin   
F GTGGCGTACAGGACATTGTG 58°C
R AGCTCTCGCTGGGTAATCAA  
Protamine   
F GGCCACCACCACCACAGACACAGGCG 66°C
R TTAGTGATGGTGCCTCCTACATTTCC  
Dazl   
F GTGTGTCGAAGGGCTATGGAT 61°C
R ACAGGCAGCTGATATCCAGTG  
PCNA   
F 5′ GATGCCGTCGGGTGAATTTG 3′ 55°C
R 5′ TCTCTATGGTTACCGCCTCCT 3′  
SCP3   
F 5′ TGTTGCAGCAGTGGGAACTGGAT 3′ 68°C
R 5′ CCATCTCTTGCTGCTGAGTTTCCA 3′  
18s   
F 5′ GTCCCGTAGACAAAATGGTGA 3′ 58°C
R 5′ TGCATTGCTGACAATCTTGAG 3′  
Gapdh   
F GTCCCGTAGACAAAATGGTGA 58°C
R TGCATTGCTGACAATCTTGAG