Skip to main content

Table 1 Primer sequences of the transcripts for s100 g, cyr61, tnfip6, ampd3 and gapdh

From: Participation of the oviductal s100 calcium binding protein G in the genomic effect of estradiol that accelerates oviductal embryo transport in mated rats

Gene Sense Antisense Length of band
s100 g GGCAGCACTCACTGACAGC CAGTAGGTGGTGTCGGAGC 307 bp
cyr61 ATCTACCAGAACGGGGAGAG TATTAACTCCACCTCCGAGG 253 bp
tnfip6 TGACAGTTATGACGATGTCC GCCTTGATTGGATTTAGGTGC 167 bp
ampd3 CACCCTATGACATGCCTGAG CAAAGAGAACACCTCCCTGC 320 bp
gapdh ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA 498 bp