Skip to main content

Table 1 The primers used for Real-Time polymerase chain reaction (PCR).

From: Genome-wide profiling of gene expression in the epididymis of alpha-chlorohydrin-induced infertile rats using an oligonucleotide microarray

Target genes Sense (5'-3') Antisense (5'-3') Size of product (bp)
β-actin CTGGGTATGGAATCCTGT GG TCATCGTACTCCTGCTTGCTG 290
Gapds GAATCGCCATTA AAGTCCGT GGCAAAGTCATCCCAGAG C 141
Lep TCTGTGGAGTAGAGCGAGGCT TTCACCCCATTCTGAGTTTGT C 123
Atp6v1g3 TGGGCTTGGAAGGACGAG GAGACCGACCAGTACAGAATGC 234