Figure 1From: Transforming growth factor beta family expression at the bovine feto-maternal interfaceCharacteristics of fibroblastic cells (C cell) derived from trophoblastic tissue with male fetus. Lane 1: stromal cells derived from mother endometrium, Lane 2: epithelial cells derived from mother epithelium, Lane 3: dermal cells from mother skin, Lane 4: stromal cells from trophoblastic tissue: Lane 5: stromal cells from fetus, Lane 6-10: fibroblastic cells (C cell) from trophoblastic tissue which has male fetus. These cells were established from different conceptus, respectively. btDYZ was amplified with RT-PCR using following male specific gene primers [28]. btDYZ, Forward: CCTTTAGGGGAAAATGGACTGACA, Reverse: ATGTGACACTGCTGGAAGG. brDNA (bovine ribosomal DNA, Control), Forward: CCAGTGCTCTGAATGTCAAA, Reverse: GCCTCCCAGTTATTCTACAC.Back to article page