Skip to main content

Table 1 Primer-specific conditions used for quantitative PCR analysis

From: Expression of nodal signalling components in cycling human endometrium and in endometrial cancer

Gene Primer sequence (5'-3') size (bp) Mg2+(mM) Anneal temp (°C) Ex'sion time (s) Read temp (°C)1
Cripto F AAGATGGCCCGCTTCTCTTACAGT 511 2 64 20 88
  R AAAGTGGTAGTACGTGCAGACGGT      
Nodal F AGACATCATCCGCAGCCTACA 330 3 59.2 20 88
  R GTCCATCTGAAACCGCTCTAAG      
Lefty A F GGGAATTGGGATACCTGGAT 206 3 62 25 80
  R CTAAATATGCACGGGCAAGG      
β-Actin F CGAGCGCGGCTACAGCTT 500 2 64 14 85
  R TCATACTCCTGCTTGCTGATCC      
  1. 1 The temperature (temp) at which the fluorescence of the PCR product was quantified during LightCycler analysis.