Table 1 Primer sequences for Real-time PCR analyses of gene expression
From: Di-(2 ethylhexyl) phthalate and flutamide alter gene expression in the testis of immature male rats
Transcript ID | Gene Symbol | Â | Sequense (5'-3') | Size |
|---|---|---|---|---|
NM_031558 | StAR | Forward | tcaaggaatcaaggtcctg | 208 |
| Â | Â | Reverse | tgttcagctctgatgacacc | Â |
NM_017286 | Cyp11a1 | Forward | Atccagcttctttcccaatc | 229 |
| Â | Â | Reverse | caggatgaggttgaacttgg | Â |
NM_017265 | HSD3b | Forward | Cgctgctgtcattgatgtct | 299 |
| Â | Â | Reverse | tatgcagtgtgccaccattt | Â |
NM_133529 | Cabp1 | Forward | tgactttgtggaactgatgg | 232 |
| Â | Â | Reverse | gaagtccactcgtccatctc | Â |
XM_216030 | Vav2 | Forward | cagaggagacggctgaaaac | 338 |
| Â | Â | Reverse | gatgaggtcctccaggttga | Â |
NM_145880 | Lhx1 | Forward | Ttctggaccgtttcctcttg | 198 |
| Â | Â | Reverse | gaaccagatcgcttggagag | Â |
NM_001014242 | Isocl | Forward | acacgtctgtatccagcaga | 227 |
| Â | Â | Reverse | Tggccttaattaggttctgg | Â |
NM_017035 | Plcd1 | Forward | agctgccaaaggtcaataag | 238 |
| Â | Â | Reverse | ctctggccaataaagtcgtt | Â |