Skip to main content

Table 1 Primer sequences for Real-time PCR analyses of gene expression

From: Di-(2 ethylhexyl) phthalate and flutamide alter gene expression in the testis of immature male rats

Transcript ID Gene Symbol   Sequense (5'-3') Size
NM_031558 StAR Forward tcaaggaatcaaggtcctg 208
   Reverse tgttcagctctgatgacacc  
NM_017286 Cyp11a1 Forward Atccagcttctttcccaatc 229
   Reverse caggatgaggttgaacttgg  
NM_017265 HSD3b Forward Cgctgctgtcattgatgtct 299
   Reverse tatgcagtgtgccaccattt  
NM_133529 Cabp1 Forward tgactttgtggaactgatgg 232
   Reverse gaagtccactcgtccatctc  
XM_216030 Vav2 Forward cagaggagacggctgaaaac 338
   Reverse gatgaggtcctccaggttga  
NM_145880 Lhx1 Forward Ttctggaccgtttcctcttg 198
   Reverse gaaccagatcgcttggagag  
NM_001014242 Isocl Forward acacgtctgtatccagcaga 227
   Reverse Tggccttaattaggttctgg  
NM_017035 Plcd1 Forward agctgccaaaggtcaataag 238
   Reverse ctctggccaataaagtcgtt