Skip to main content

Table 1 Oligonucleotide primers used in semi-quantitative RT-PCR analysis.

From: Upregulated mRNA expression of desaturase and elongase, two enzymes involved in highly unsaturated fatty acids biosynthesis pathways during follicle maturation in zebrafish

Gene Amplicon Sense 5'-3' Anti-sense 5'-3'
fadsd6 336 nt CATCACGCTAAACCCAACATC GCTCTCCATAAACCTGACGAAA
elovl5 474 nt TGGACACCTTCTTCTTCATCC TCTTCTCGCTGGACATCACTC
h2afz 159 nt AGTTTTGGAGTTGGCAGGAAAT AGAGACTTGTGGATGTGTGGAAT