Skip to main content

Table 1 Oligonucleotide primers used for real-time PCR, template amount and their annealing temperatures.

From: Impaired leukocyte influx in cervix of postterm women not responding to prostaglandin priming

Gene Accession No. or Reference Primer
F = forward; R = reverse
Position cDNA Annealing step
MMP-2 BC002576 F: gtatttgatggcatcgctca bp 1695-1714 40 ng 56°C/20s
   R: cattccctgcaaagaacaca bp 1891-1871   
    product bp 198   
MMP-8 NM_002424 F: ctttcagggaaaccagcaac bp 790-809 80 ng 55°C/20s
   R: gcttggtccagtaggttgga bp 893-874   
    product bp 104   
MMP-9 BC006093 F: cgctaccacctcgaactttg bp 1124-1143 40 ng 56°C/20s
   R: gccattcacgtcgtccttat bp 1319-1300   
    product bp 198   
TIMP-1 NM_003254 F: tgacatccggttcgtctaca bp 299-318 40 ng 56°C/20s
   R: tgcagttttccagcaatgag bp 400-381   
    product bp 102   
TIMP-2 PMID
15231657
[50]
F: gagcctgaaccacaggtacca bp 728-748 40 ng 58°C/15s
   R: tctgtgacccagtccatcca bp 841-822   
    product bp 114   
PAF-R NM_000952 F: cagagacacacggtcactgc bp 44-63 40 ng 56°C/15s
   R: catgtgggaggagtcatgtg bp 154-135   
    product bp 111   
S-1 NM_002997 F: ggagcaggacttcacctttg bp 869-888 50 ng 59°C/30s
   R: cccagcacctctttcctgt bp 1009-991   
    product bp 141   
ERα NM_000125 F: cttgctcttggacaggaacc bp 1581-1600 80 ng 56°C/20s
   R: tcctctccctgcagattcat bp 1691-1672   
    product bp 111   
ERβ NM_001437 F: tgcggaacctcaaaagagtc bp 715-734 80 ng 56°C/20s
   R: catccctctttgaacctgga bp 854-835   
    product bp 140   
GPR30 NM_001505 F: agactgtgaaatccgcaacc bp 364-383 100 ng 57°C/15s
   R: aagtgagcctggcatttgt bp 663-644   
    product bp 300   
Cyclophilin A XM_004890 F: gtggtgtttggcaaagtgaa bp 401-420 40 ng 56°C/20s
   R: tcgagttgtccacagtcagc bp 516-497   
    product bp 116