Skip to main content

Advertisement

Table 1 Primer sequences for qPCR.

From: Identification of differentially expressed ovarian genes during primary and early secondary oocyte growth in coho salmon, Oncorhynchus kisutch

Putative gene name and symbol 5'-Forward primer-3' 5'-Reverse primer-3' Product size (bp)
Genes identified by SSH    
Factor in the germline α (figla) TCTTGAAGAATGCGATCAACTATGC CACTCACGTCTCCATCTCCTGC 177
Zona pellucida protein X (zpx) TTGTGACACCTTGTTCCGCC TCGCAACTACACGCCCTTAGAC 257
Zona pellucida protein C (zpc) CAGGAAAGCATCCACAGTGAAGC TTTGTTACGACATCCAATGACCC 153
Egg envelope glycoprotein (eeg) TGGTGTCATCTGTCTCTTGAGGC TTTGAAGCAGTTCTACGGCTCG 233
Somatic lipoprotein receptor (vldlro) AACAGAGCAACAACCAGATGCC TAGAACCAGTATCACGCCCTGC 278
Cathepsin B, a (ctsba) GAACACTGACTGGGGAGATAATGG CTCTGATAGGGTGGAGTTTCCTTTC 222
Cathepsin D (ctsd) CGTCATCTTTGACTCCCGATCC GCACAAGTTTCCATTTGCTTTTCTG 175
Cathepsin Z (ctsz) TCCCATCGTTCCCAAAACCTAC TGTTCCCAAGGCAAAGCACG 200
Serum lectin isoform 2 (lcal) CAGGTTCTTATGGAGCACACGG GTTCAAGCAAAGGTGGAAAAGGAC 203
Rhamnose binding lectin STL3 (lrham) ACCAACTCACCGACACCAACTG CCCAATGGAACACACATCGTG 290
Alveolin (alv) ACAGAGAAATCACCTGAGCCCC GGAGAAATAAAACCACTGCCTGC 253
Ferritin H-3 (fth3) ACTCTCCTTCCAGAACAAGCGAG TTGGTGAGGTTGGTGATGTGG 264
DnaJ subfamily A member 2 (dnaja2) TGTCTGCCATCTAAGTGTTTCAACG CGCTGTAAAAAGTGCGAGGGC 278
Cyclin E (ccne) GTTCAAAGGAATCCCAGCAGATG TCACCGTAGCACAATAAACACCC 215
Retinol dehydrogenase 1 (rhd1) GTTCAGGCAGATTCACCACCC CGATGACCCCGTTCAGGTTC 210
Coatomer complex protein, epsilon (cope) CAGATGTCTCCATTGTCTCAAGCAG TGACCCAGCACTTAGGCAAAGC 175
Anterior pharynx defective 1b (aph1b) CTGCTGAAGAAGGCAAACGAAG AGGAATCAAAGAACACCACACCC 268
Candidate genes    
Vitellogenin receptor (vldlr) TCTGGAAGTGTGATGGAGAGAAGG TCGCTGGGTGAACATTTAGCC 337
Apolipoprotein E (apoe) AGGGAGGACATCCAGACCAAGTTG CGTTTCTTCAGTTTGCGGGTGTAG 218
Lipoprotein lipase (lpl) GTGCCTCAACTGCCGTAAGAAC TGCCCCAAATGTCAGACCAG 365
FSH receptor (fshr) GACGCACATCAGAGTGTTTCCC GTAGAACCCTCAGTCCAGTGTTGC 242
Anti-Müllerian hormone (amh) TCACTTTCACCAGTCACTCTCTGC CACTTCTTGTTCCGTCACCAATC 204
Gonadal soma-derived growth factor (gsdf) CCAGAATCAAGAAGGAATACGCAG TGGGAAAAGAGAGGAGAGCAGG 317
Elongation factor-1α (ef1a) CCCCTGGACACAGAGATTTCATC AGAGTCACACCGTTGGCGTTAC 409