Skip to main content

Advertisement

Table 1 Primers used for real-time RT-PCR

From: Food intake regulating-neuropeptides are expressed and regulated through pregnancy and following food restriction in rat placenta

mRNA Primer Sequence (5'-3') Product size (bp) Accession Number
NPY Forward cgctctgcgacactacatca 157 NM_012614
  Reverse tttcatttcccatcaccaca   
AgRP Forward tgtgggccctttattagacc 156 XM_574228
  Reverse ccatatggacccccaatgt   
POMC Forward tccatagacgtgtggagctg 174 NM_139326
  Reverse gacgtacttccggggatttt   
CART Forward gccctggacatctactctgc 201 NM_017110
  Reverse cactgcgcactgctctcc   
HPRT Forward cagtcccagcgtcgtgatta 137 NM_012583
  Reverse agcaagtctttcagtcctgtc