Skip to main content

Table 1 Forward and reverse primer sequences, RT-PCR product length and accession number (Acc.No.) in the EMBL database.

From: Prostaglandin F2-alpha receptor (FPr) expression on porcine corpus luteum microvascular endothelial cells (pCL-MVECs)

Primer Sequence (5'-3') Product Length (bp) Acc. No.
FPr For.: TCAGCAGCACAGACAAGG
Rev.: TTCACAGGCATCCAGATAATC
151 AY043485
StAR For.: GGACATCCTCAGCAACCAG
Rev.: GTCCACCACCACCTCCAG
121 U53020
HPRT For.: GGACAGGACTGAACGGCTTG
Rev.: GTAATCCAGCAGGTCAGCAAAG
115 AF143818