Skip to main content

Table 2 Description of the primers used for RT-PCR. The sequences, the number of cycles, annealing temperature (Tm) and product size of primers used for RT-PCR analysis.

From: Non-infected preterm parturition is related to increased concentrations of IL-6, IL-8 and MCP-1 in human cervix

Genes 5' Primer 3' Primer Cycles Tm °C Size bp
IL-8 TCTCTTGGCAGCCTTCCT AATTCTCAGCCTCTTCAAAAACTT 34 61 276
MCP-1 CTCTGCCGCCCTTCTGTGCC GTCTTCGGAGTTTGGGTTTGC 28 61 288
RANTES CGGCACGCCTCGCTGTCATC TGTACTCCCGAACCCATTT 34 61 240
28S GTGCAGATCTTGGTGGTAGTAGC AGAGCCAATCCTTATCCCGAAGTT 19 58 552