Skip to main content

Table 1 Description of primers and probes used for Real-time RT-PCR. Accession number (Entrez Nucleotide Database), sequences of primers and probes for human iNOS, eNOS, and bNOS; optimal primer and probe concentrations; number of PCR-cycles.

From: mRNA expression and localization of bNOS, eNOS and iNOS in human cervix at preterm and term labour

Target Accession # Type Sequence Concentration (nM) N cycles
iNOS XM_034166 FWD TGGATGCAACCCCATTGTC 300 60
   REV CCCGCTGCCCCAGTTT 50  
   Probe 6FAM-TCCCCACGGCATGTGAGGATCA-TAMRA 200  
eNOS AF400594 FWD CGGCATCACCAGGAAGAAGA 300 50
   REV CATGAGCGAGGCGGAGAT 300  
   Probe 6FAM-TTCACGGCGTTGGCCACTTCTTTAAA-TAMRA 200  
bNOS NM_000620 FWD GGATCACATGTTCGGTGTTCAG 300 50
   REV CCCAACTTTGCGCTTGAAGA 900  
   Probe 6FAM-AAATCCAGCCCAATGTCATTTCTGTTCG-TAMRA 200