Skip to main content

Table 1 Details of primers used for real-time RT-PCR

From: Suitable housekeeping genes for normalization of transcript abundance analysis by real-time RT-PCR in cultured bovine granulosa cells during hypoxia and differential cell plating density

Symbol Name Sequence
B2M Beta-2-microglobulin F:ACGCTGAGTTCACTCCCAACAGCAA
R:TCGATGGTGCTGCTTACAGGTCTCG
GAPDH Glyceraldehyde-3-phosphate dehydrogenase F:AGCGAGATCCTGCCAACATCAAG
R:GCAGGAGGCATTGCTGACAATCT
HMBS Hydroxymethylbilane synthase F:CAGCATGAAGATGGCCCTGAAGATG
R:CTCAGGTAGCAGAGGGCTGGGATGT
HPRT1 Hypoxanthine phosphoribosyltransferase 1 F:TGAAAAGGACCCCTCGAAGTGTTGG
R:CGCCAGGTATTTCCAAACTCAACTCG
RPLP0 Ribosomal protein, large, P0 F:TGGTTACCCAACCGTCGCATCTGTA
R:CACAAAGGCAGATGGATCAGCCAAG
RPS18 Ribosomal protein S18 F:GAGGTGGAACGTGTGATCACCATT
R: TGTATTTCCCGTCCTTCACGTCCT
TBP TATA box binding protein F: GCCTTGTGCTTACCCACCAACAGTTC
R: TGTCTTCCTGAAACCCTTCAGAATAGGG