Skip to main content

Advertisement

Table 2 The primer sequences (5’-3’) used in qRT-PCR

From: RUNX2, GPX3 and PTX3 gene expression profiling in cumulus cells are reflective oocyte/embryo competence and potentially reliable predictors of embryo developmental competence in PCOS patients

Gene symbol Accession nr Forward primer Reversed primer Fragment length
GAPDH NM_002046 TGTTGCCATCAATGACCCCTT CTCCACGACGTACTCAGCG 202
RUNX2 NM_001015051.3 TCCAGGAGGACAGCAAGAAGT TGTCACTGTGCTGAAGAGGCT 182
PSAT1 NM_021154 .3 ATGGGCTTGGTTCTGGAGTG GGCCAGCTTCTGAACGTCTT 324
ADAMTS9 NM_182920.1 AGGGTCGTTTTAGCATCAACC TCCACAGTAACCACCGCATT 149
CXCL1 NM_001511.2 CCCAAACCGAAGTCATAGCC CCTTCAGGAACAGCCACCAG 158
CXCL2 NM_002089.3 CCCAAACCGAAGTCATAGCC CAGGAACAGCCACCAATAAGC 154
CXCL3 NM_002090.2 CACTCAAGAATGGGAAGAAAGC GCAGGAAGTGTCAATGATACGC 142
ITGB5 NM_002213.3 GACCGGAGGGAGTTTGCAA CCTCGGAGAAGGAAACATCAGT 170
GPX3 NM_002084.3 GGCTTTGTCCCTAATTTCCAG AAAGTTCCAGCGGATGTCGT 171
PTX3 NM_002852.3 GCATCTCCTTGCGATTCTGTT CATTCCGAGTGCTCCTGACC 165