Skip to main content

Table 1 PCR primers

From: Endometrial stromal beta-catenin is required for steroid-dependent mesenchymal-epithelial cross talk and decidualization

Murine Gene Primer sequence Annealing temperature Cycles
Pgr 5’ATGGTCCTTGGAGGTCGTAA3’ 5’CACCATCAGGCTCATCC3’ 60 34
Esr1 5’CCAAAGCCTCGGGAATG3’ 5CTTTCTCGTTACTGCTGG3’ 56 33
Esr2 5’GGGCCTGTTCGCCAGACTGC3’ 5’CAGGGATTTTCTTGGC3’ 56 33
Ihh 5’CGTGCATTGCTCTGTCAAGT3’ 5’CTCGATGACCTGGAAAGCTC3’ 56 37
Pct1 5’CCTCCTTTACGGTGGACAAA 3’ 5’ GCCACATCAAGAGGTTTGGT 3’ 56 40
Gli1 5’CCTGGTGGCTTTCATCAACT3’ 5’GTGGTACACAGGGCTGGAGT3’ 56 38
β-actin 5’GATGACGATATCGCTGCGCTG3’ 5’GTACGACCAGAGGCATACAGG3’ 60 26