Skip to main content

Table 6 Details of primers used for RT-PCR

From: In vitro and in vivodevelopment of mice morulae after storage in non-frozen conditions

Gen symbol MGI official name Primers sequence (5– 3) Fragment size Gene bank accesion n°
Bax BCL2-associated X protein 5 CTACTTTGCCAGCAAACTGG 159 NM_007527.3
3 TCCCAAAGTAGGAGAGGA
Bcl2 BCL2-like 1 5 GGAGCTGGTGGTTGACTTTC 517 NM_009743.4|
3 CTAGGTGGTCATTCAGGTAAG
ErV4 Murine endogenous retovirus-L 5 TGCTTGGGCTCAGCAACATGG 278 XM_001478088.1|
3 GACAGAATGCCTCATCTATCGT
Iap Intracisternal-A particle 5 GGGTATTGTTGAGCGTGCGC 333 XM_001477167.1|
3 TCGGGTGAGTCTTTCTGGTAC
Terf1 Telomeric repeat binding factor 1 5 TTCAACAACCGAACAAGTGTC 215 Mm 4306
3TCTCTTTCTCTTCCCCCTCC
Cx43 (Gaj1) Gap junction membrane channel protein alpha 1 5TACCACGCCACCACTGGCCCA 290 Mm 4504
3ATTCTGGTTGTCGTCGGGGAAATC
Nanog Nanog homebox 5AGGGTCTGCTACTGAGATGCTCTG 363 Mm 6047
3CAACCACTGGTTTTTCTGCCACCG
Oct3/4 (Pou5f1) POU domain, class 5, transcription factor 1 5GGAGAGGTGAAACCGTCCCTAGG 312 Mm 17031
3AGAGGAGGTTCCCTCTGAGTTGC
Gapdh Glyceraldehyde-3-Phosphate dehydrogenase 5GGGTGTGAACCACGAGAAATATGA 250 Mm 379644
3CCTTCCACAATGCCAAAGT
H2afz Histone H2az 5TGTGTACAGCGCAGCCATCCTG 208 NM_016750.2
3CTTCCCGATCAGCGATTTGTGG