Skip to main content

Table 1 Oligonucleotide primers and probes used for real-time RT-PCR analysis

From: Relationship between quantity of IFNT estimated by IFN-stimulated gene expression in peripheral blood mononuclear cells and bovine embryonic mortality after AI or ET

Gene GenBank accession no. Sequence Position
(nucleotide no.)
ISG15 NM_174366 Forward primer 5' GGGACCTGACGGTGAAGATG 3' 67-86
   Reverse primer 5' GAAAGCAGGCACATTGATCTTCT 3' 160-182
   TaqMan probe 5' TCCTGGTGCCTCTGAGGGACTCCAT 3' 103-127
Mx2 NM_173941 Forward primer 5' AAATCACCTACCGCAACATTACG 3' 772-794
   Reverse primer 5' GCCAAGTCCATTCCCAGCTA 3' 853-872
   TaqMan probe 5' ATGTTCTGGGCTCTCCGA 3' 833-850
GAPDH U85042 Forward primer 5' GGCACAGTCAAGGCAGAGAAC 3' 238-258
   Reverse primer 5' GGATCTCGCTCCTGGAAGATG 3' 291-311
   TaqMan probe 5' CATCAATGGAAAGGCCA 3' 270-286