Skip to main content

Table 1 Gene references, primer sequences, hybridization temperature during PCR and theoretical length of amplified fragments

From: Interleukin-1 (IL-1) system gene expression in granulosa cells: kinetics during terminal preovulatory follicle maturation in the mare

Equine gene Genbank references primer (5' to 3') strand Temperature of hybridization length of amplified fragments
Glyceraldehyde-3-Phosphate Deshydrogenase (gapdh) af157626 GTTTGTGATGGGCGTGAACC TTGGCAGCACCAGTAGGAGC s a-s 62°C 255 bp
Interleukin-1α u92480 GCCAATGATCCAGAAGAAGG CAGTTTTCCCTGCTTTGTGG s a-s 60°C 450 bp
Interleukin-1β u92481 GGTGTTCTGCATGAGCTTTG TTTCTGCTTGAGAGGTGCTG s a-s 60°C 266 bp
Interleukin-1ra u92482 TGCAAGATGCAAGCCTTCAG TGGAGGTAGAACTTGGTGAC s a-s 60°C 425 bp
Interleukin-1R1 ab020338 TGATCTGCAATGTCACTGGC AATCCCTGTACCAAAGCACC s a-s 60°C 372 bp
Interleukin-1R2 ab033415 ATGCTCTCTGGATTTTGCCG TACGAGTAAACGAGGGGGTC s a-s 62°C 311 bp
  1. s: sense primer, a-s: anti-sense primer