Skip to main content

Table 1 Primers for FSH and LH receptors and Connexin-43.

From: Responsiveness of bovine cumulus-oocyte-complexes (COC) to porcine and recombinant human FSH, and the effect of COC quality on gonadotropin receptor and Cx43 marker gene mRNAs during maturation in vitro

  5' (5'-3') 3' (5'-3') Primer binding temp. (°C) Product size (bp)
FSHr CAACCTGCTATACATCGACC GAGCAAGTCACATCAACCAC 53 723 537
LHr AGAGTGAACTGAGTGGCTGG CAACACGGCAATGAGAGTAG 53 533
Cx43 TGGCTGCTCCTCACCAACG/CGC AGGTCATCAGGCCGAGGT/CCTG 58 334