Skip to main content

Table 1 RT–qPCR primers used in the study

From: Transcriptome analysis of eutopic endometrium in adenomyosis after GnRH agonist treatment

Gene symbol Forward primer (5′–3′) Reverse primer (5′–3′)
RAB7B CTCATTATCGTCGGAGCCATTG AGTGTGGTCTGGTATTCCTCATA
GALNT13 TTGCCCTTAATAGAAGTCTGCCA TGGGGAACGATTTATCACACTG
CFD GACACCATCGACCACGACC GCCACGTCGCAGAGAGTTC
LHFPL3 CCTACTGGATAGGCGACGG GAGGCCGATAAAGAAGGAGGC
PLAC9 GAGCACAGCGTGTGACAGA GATCCACGGTCTTCTCTACCA
SCARA5 AAAGCTATGTACCTACACACCGT CCGCCGTTTGTGACATGGA
EBF1 AAAGCATCCAACGGAGTGGAA GCCCTGTCTGTCGTAGAGG
CCL21 GTTGCCTCAAGTACAGCCAAA AGAACAGGATAGCTGGGATGG
EPHA7 AGAACTATACCCCGATACGAACA TGGAAATCCAGTTAGTCCGCA
PCDH10 TGGATGGTGGAAGGAGTCTTT TTCAGCGATATTCCCCACGAA
THEM4 GAACAAGGACCTAAGACTGCTC AGAACATCACGTATTCAAAGCCC
PPP2R3B TCCGCAGGGACGAGAGTAG AAGGTCGGAATGCTTTGGCTC
ACTB CATGTACGTTGCTATCCAGGC CTCCTTAATGTCACGCACGAT
  1. Note: ACTB (β-actin) was used as an internal control
  2. Abbreviation: RT-qPCR quantitative reverse transcription PCR