Skip to main content

Table 1 Primers used in this study

From: The Spin1 interactor, Spindoc, is dispensable for meiotic division, but essential for haploid spermatid development in mice

Gene name Sequence(5′-3) Application
Spindoc ATGCTGGTTGGCTAGGATCT Genotyping
  CTGGTCAGCTTGGATGTCTT  
Spindoc GGTGGTGGCCGTGATCC RT-qPCR
  CTGTTCCCCACCAGGAACTC  
Spindoc CGGCCTAACCTGCTGGAAGC sgRNA
  CAGTGGACGGGCGCTGTGCA