Skip to main content

Table 1 Primer sequences for RT-qPCR

From: Evaluation of testicular glycogen storage, FGF21 and LDH expression and physiological parameters of sperm in hyperglycemic rats treated with hydroalcoholic extract of Securigera Securidaca seeds, and Glibenclamide

Gene Forward primer (5′-3′)
Reversed primer (5′-3′)
Melting temperature (Tm)
GAPDH TCATCAACGGCACAGTCAAGG
TTCTGCATGGTGGTGAAGACG
60.88
60.88
LDH-C TTTAGCCTTTTCCTCAGCACTCC
AGTCTAGGTTACAGCCACTTCC
60.81
59.17
FGF-21 TTCGGGACTGTGGGTCTGTCTC
TTTGCAGGTGGGCTTCGGTG
62.6
62.1