Skip to main content

Table 1 Primers used in this study

From: Silencing of MEG3 attenuated the role of lipopolysaccharides by modulating the miR-93-5p/PTEN pathway in Leydig cells

Gene primer Sequence
MEG3 Forward 5′- GGCAGGATCTGGCATAGAGG − 3’
Reverse 5′- CGAGTCAGGAAGCAGTGGGTT-3’
PTEN Forward 5′- ACCCACACGACGGGAAGACA − 3’
Reverse 5′- CTGTTTGTGGAAGAACTCTACTTTGATATCAC − 3’
β-actin Forward 5′- CATTCCAAATATGAGATGCGTTGT − 3’
Reverse 5′- TGTGGACTTGGGAGAGGACT − 3’
miR-93-5p Forward 5′- GTCACAAAGUGCUGUUCGUGC-3’
Reverse Transcription 5′-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTACCTG − 3’
U6 Forward 5′- CTCGCTTCGGCAGCACA-3’
Reverse 5′- AACGCTTCACGAATTTGCGT-3’