Skip to main content

Table 1 Primer sequences for gene expression by qRT-PCR

From: Hindlimb unloading-induced reproductive suppression via Downregulation of hypothalamic Kiss-1 expression in adult male rats

Gene Forward primer (5′–3′) Reverse primer (5′–3′) Accession No Product size (bp)
Aromatase GCCTGTCGTGGACTTGGT GGTAAATTCATTGGGCTTGG NM_017085.2 142
FSHβ AGACCAAACACCCAGAAAG TCACTATCACACTTGCCACA NM_001007597.2 140
LHβ CATAGTCTCCTTTCCTGTGGC CATTGGTTGAGTCCTGGGA NM_012858.2 91
GnRH GGCTTTCACATCCAAACAGAATG TGATCCTCCTCCTTGCCCAT NM_012767.2 181
GnRHR TCAGGACCCACGCAAACTAC CTGGCTCTGACACCCTGTTT NM_031038.3 182
Kiss 1 TGCTGCTTCTCCTCTGTGTGG ATTAACGAGTTCCTGGGGTCC NM_181692.1 110
Kiss 1R CTTTCCTTCTGTGCTGCGTA CCTGCTGGATGTAGTTGACG NM_023992.1 102
GAPDH GTGCCAGCCTCGTCTCATAG CGTTGATGGCAACAATGTCCA NM_017008.4 122