Skip to main content

Table 2 The sequences of all primers

From: Berberine exerts a protective effect on rats with polycystic ovary syndrome by inhibiting the inflammatory response and cell apoptosis

Primer Sequence(5′-3′)
TLR4-rF GTTCCTTTCCTGCCTGAGACC
TLR4-rR AGGGTTTCCTGTCAGTACCA
LYN-rF TGAAGACTCAACCAGTTCCTGA
LYN-rR TTAGCTTTCCACCACTCCCC
PI3K-rF GCAAAAGCTTGAAAGCCTGC
PI3K-rR CAGGGGCTTCTTCTTGGAGG
Akt-rF TAGCCATTGTGAAGGAGGGC
Akt-rR CCTGAGGCCGTTCCTTGTAG
NF-κB-rF TGCCGAGTAAACCGGAACTC
NF-κB-rR CAGCCAGGTCCCGTGAAATA
TNF-α-rF ATGGGCTCCCTCTCATCAGT
TNF-α-rR AAATGGCAAATCGGCTGACG
IL-1-rF ACAAAAATGCCTCGTGCTGTC
IL-1-rR GTGCCGTCTTTCATCACACAG
IL-6-rF TCTGGTCTTCTGGAGTTCCG
IL-6-rR AGCATTGGAAGTTGGGGTAGG
caspase-3-rF TACTCTACCGCACCCGGTTA
caspase-3-rR CGCGTACAGTTTCAGCATGG
CD14-rF ACTTCTCAGATCCGAAGCCAG
CD14-rR CCGCCGTACAATTCCACAT
COL15A1-rF CCCATTACCCTCGTCTGTGTC
COL15A1-rR CTGAAGAAGGTCGGTGGGATG
LY96-rF GAATCTGAGAAGCAACAGTGGT
LY96-rR CTCAACATGCACAAATCCATTGG
CXCL6-rF GTTCCATCTCGCCATTCATGC
CXCL6-rR GCGGCTATGACTGAGGAAGG
CXCL16-rF CCTTGTCTCTTGCGTTCTTCC
CXCL16-rR TCCAAAGTACCCTGCGGTATC
SHC4-rF GAGGAGGTACTTGTTGATGGTG
SHC4-rR TCTGTAGCTTGAGCCTGGATG
GAPDH-rF AGACAGCCGCATCTTCTTGT
GAPDH-rR CTTGCCGTGGGTAGAGTCAT