Skip to main content

Table 1 Primer sequences of the qRT-PCR analysis

From: Combined use of Diane-35 and metformin improves the ovulation in the PCOS rat model possibly via regulating glycolysis pathway

GeneSequence (5′-3′)Annealing TemperatureProduct (bp)GeneBank No
PCNAF: GCTCCATCCTGAAGAAGGT55 °C121NM-022381.3
 R: TGCACTAAGGAGACGTGAGA   
BaxF: GAGACACCTGAGCTGACCTT55 °C104NM-017059.2
 R: TCCATGTTGTTGTCCAGTTC   
Bcl-2F: AGTACCTGAACCGGCATCT55 °C120NM-016993.1
 R: CCGGTTACTATTCCTGGAGA   
Caspase-3F: CCGGTTACTATTCCTGGAGA55 °C117NM-017008.4
 R: TAACACGAGTGAGGATGTGC   
MCT4F: CCTTCCTTCTCACCATCCT55 °C136BC168146.1
R: TCAGTGAAGCCATTGAAGAA
MCT2F: GGATTGGGATTTGGAAGTAT55 °C119NM-003676.8
R: AGAACTGGACAACACTCCAC
GLUT1F: TGGCTCCTCATGTCAGAGA55 °C125AJ245935.1
R: AGGATCTCCATGATGCTGTT
HKF: AGAGGCTACGGACAGAGATG55 °C121NM-012734.1
R: AGGAAGTCACCGTGTTCAGT
PFKF: GGCGTGTGTTCATTGTAGAG55 °C125NM-017008.4
R: CTTCAAGTCGTGGATGTTGA
PKMF: ACATCCTGTGGCTGGACTAT55 °C130NM-053297.2
R: TCCACTTCTGTCACCAGGTA
LDHF: GGTTGACAGTGCATACGAAT55 °C106NM-017025.1
R: CCGCCTAAGGTTCTTCATTA
GAPDHF: CCTCAAGATTGTCAGCAATG55 °C134NM-017008.4
R: CAGTCTTCTGAGTGGCAGTG