Skip to main content

Table 1 Primers used for Real-time PCR

From: Prostaglandin E2 affects in vitro maturation of bovine oocytes

Gene SymbolGene NamePrimer sequence (5′-3′)Fragment size, bpGen Bank accession no.
PTGS2prostaglandin endoperoxide synthase 2TGGGTGTGAAAGGGAGGAAA
AAGTGCTGGGCAAAGAATGC
127NM_174445.2
PTGESmicrosomal prostaglandin E synthase 1TGCTGGTCATCAAAATGTACG
GCAGTTTCCCCAGGTATGC
300NM_174443.2
PTGES2microsomal prostaglandin E synthase 2CCTCCTACAGAAAGGTGCC
GTGATGATGTCTGCCAGGG
133NM_001166554.1
PTGES3cytosolic prostaglandin E synthaseTGCAAAGTGGTACGATCGG
TAACCTTGGCCATGACTGG
253NM 001007806
PTGER1prostaglandin E2 receptor 1GAGTCCCTTGCTGGTGGTGGT
CTGGTTCCACGAGGCGAGGC
103NM_001192148.1
PTGER2prostaglandin E2 receptor 2GCTCCTTGCCTTTCACGATTTT
CTCAGGATGGCAAAGACCCAA
130NM_174588.2
PTGER3prostaglandin E2 receptor 3CATACTGGGGCTCTCGGCG
TCATTATCAGCAACGGCGACCA
200NM_181032.1
PTGER4prostaglandin E2 receptor 4CATCCCGCTTGTGGTGCGAG
AGGGTTTTTGCCGATGACTGG
76NM_174589.2
CTSBcathepsin BGGCTCACCCTCTCCAGTCCT
TCACAACCGCCTTGTCTGAA
136NM 174031.2
CTSKcathepsin KGAACCACTTGGGGGACATGA
GGGAACGAGAAGCGGGTACT
77NM 001034435.1
CTSScathepsin SCCGCCGTCAGCATTCTTAGT
CATGTGCCATTGCAGAGGAG
99NM 001033615.1
CTSZcathepsin ZGGGGAGGGAGAAGATGATGG
CCACGGAGACGATGTGGTTT
146NM 001077835.1
GLUT1glucose transporter 1GATCCACAGAGCGCAGCC
TGTCAGCTTCTTGCTGGTGG
90NM_174602.2
GLUT4glucose transporter 4ATTGTGGCCATCTTTGGCTTCGTG
AACCCATGCCGATGATGAAGTTGC
160NM_174604.1
GFPT1glutamine-fructose-6-phosphate transaminase 1AAACACAGTCGGCAGTTCCA
TGGCTACACCAATCTCAGGC
80NM_001109961.1
GFPT2glutamine-fructose-6-phosphate transaminase 2GAGATGTGCGGAATCTTTGCC
ACCTGCTGAGTCATAGCCTCT
120NM_001076883.1
PFKPphosphofructokinaseTCAGAGAACCGTGCCTGGAAGAAA
TGACCACAAGCTCCTTGATCTGCT
112NM_001193220.1
LDHAlactate dehydrogenase ATCTGGATTCAGCTCGCTTCCGTTA
TTCTTCAGGGAGACACCAGCAACA
147NM_174099.2
CATcatalaseCTGGGACCCAACTATCTCCA
GATGCTCGGGAGCACTAAAG
112NM_001035386.2
GPX4glutathione peroxidase 4GTGCTCGCTCCATGCACGA
CCTGGCTCCTGCCTCCCA
120NM_174770.4
FASFas cell surface death receptorAAAAACTGGGGCTGCCCTTA
CTTTGTGGGGGATGGAACAA
148NM_174662.2
FASLGFas ligandACTACCGCCACCACCTCTGA
GGCCACCAGAACCATGAAAA
85NM_001098859.1
TNFαtumor necrosis factor alphaCCGCATTGCAGTCTCCTACC
TGGGTTCATACCAGGGCTTG
110NM_173966.2
TNFR1tumor necrosis factor receptor 1CCACTGGTGCTTCCAGCTCT
TTTCCTTGGGGACAGGGACT
110NM_174674.2
TNFR2tumor necrosis factor receptor 2CCCCAGGACTCTGGCTCTTT
CCAAGACAGGACCCATCAGG
113NM_001040490.1
BAXBCL2 associated X, apoptosis regulatorGTGCCCGAGTTGATCAGGAC
CCATGTGGGTGTCCCAAAGT
126NM_173894.1
BCL2BCL2 apoptosis regulatorGAGTTCGGAGGGGTCATGTG
GCCTTCAGAGACAGCCAGGA
203NM_001166486.1
CASP8caspase 8CTGAGAGAAGAGGCCCGTGA
CCCGGCTTAGGAACTTGAGG
173NM_001045970.2
CASP3caspase 3TGGTGCTGAGGATGACATGG
GAGCCTGTGAGCGTGCTTTT
163NM_001077840.1
GAPDHglyceraldehyde-3-phosphate dehydrogenaseCACCCTCAAGATTGTCAGCA
GGTCATAAGTCCCTCCACGA
103NM_001034034.2