Skip to main content

Table 1 Primers used in real-time RT–PCR analyses

From: Disruption of androgen signaling during puberty affects Notch pathway in rat seminiferous epithelium

GenesForward sequenceReverse sequenceProduct size (bp)Annealing temp.(°C)
ActbAAGTACCCCATTGAACACGGATCACAATGCCAGTGGTACG25752
B2mGGACTGGTCTTTCTATATCCTGGCGATCACATGTCTCGATCCCAGTAG15058
Cldn11TGTCAACAGCAGCAAGATGGCGGCTCCAAGGGCCTGTGGGC33257
Dll1TCAGATAACCCTGACGGAGGCAGGTAAGAGTTGCCGAGGTCC18556
Dll4GCTGGAAGTGGATTGTGGCTTGTCGCTGTGAGGATAC40551
Hes1GGCAGGCGCACCCCGCCTTGGCAGCCAGGCTGGAGAGGCT17062
Hes5ACCGCATCAACAGCAGCATTAGGCTTTGCTGTGCTTCAGGT13555
Hey1AAAGACGGAGAGGCATCATCGGCAGTGTGCAGCATTTTCAGG12655
Jag1AACTGGTACCGGTGCGAATGATGCAAGATCTCCCTGAAAC21654
Notch1GCAGCCACAGAACTTACAAATCCAGTAAATGCCTCTGGAATGTGGGTGAT44556
Notch2GCTGTCCTCTTCATGCTGCAAGCAGAAGTCAAGACAGTC40551
PCITGACCCCCAAAAGGACCACTGGTCCAGGTAGTAGGAATACCCA23754
Rhox5TCATCATTGATCCTATTCAGGGTATGCTCTCCAGCCTGGAAGAAAGC38055
Rn18sCATTCGAACGTCTGCCCTATGTTTCTCAGGCTCCCTCTCC12856