Skip to main content

Advertisement

Table 1 Specific primers and probes used for 454 pyrosequencing and qPCR

From: The complex microbiome from native semen to embryo culture environment in human in vitro fertilization procedure

Study methodsTarget groups (amplicon length, Tm, assay)Primers/ProbesSequence (5′-3′)References
454 pyrosequencing16S rRNA geneTIBACB-raTTGGCAGTCTCAG (NNNNNNNN)AGAGTTTGATCCTGGCTCAGFabrice et al. 2009 [11]
TIBACA/TI357RA-faGTCTCCGACTCAG (NNNNNNNN)CTGCTGCCTYCCGTA
ACCATCTCATCCCTGCGTGTCTCCGACTCAG
BCCTATCCCCTGTGTGCCTTGGCAGTCTCAG
Real-time PCRTotal bacteria
(466 bp, 60 °C, TaqMan)
Univ-f
Univ-r
Univ (probe)
TGGAGCATGTGGTTTAATTCGA
TGCGGGACTTAACCCAACA
CACGAGCTGACGACA (AG)CCATGCA
Ott et al. 2004 [12]
Enterobacteriaceae
(195 bp, 58 °C, SYBR)
Eco1457-f
Eco1652-r
CATTGACGTTACCCGCAGAAGAAGC
CTCTACGAGACTCAAGCTTGC
Bartosch et al. 2004 [13]
Staphylococcus sp.
(560 bp, 62 °C, SYBR)
TstaG422
TstaG765
GGCCGTGTTGAACGTGGTCAAATCA
TIACCATTTCAGTACCTTCTGGTAA
Martineau et al. 2001 [14]
Corynebacterium sp.
(516 bp, 60 °C, SYRR)
CF-1
CF-2
CGTAGGGTGCGAGCGTTGTCCG
CGTTGCGGGACTTAACCCAACACT
Adderson et al. 2008 [15]
  1. aIn TIBACB and in TIBACA/TI357RA, A and B adapter sequences are underlined, the barcode is indicated by N-s in parentheses and specific primers’ sequences 8F and 357R are shown in italics. In reverse primer, the same barcode was incorporated to all samples