Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 Primer sequences for qRT-PCR

From: MicroRNA-200b and microRNA-200c are up-regulated in PCOS granulosa cell and inhibit KGN cell proliferation via targeting PTEN

  Primer Sequences
microRNA-200b-3p 5’GCTAATACTGCCTGGTAATGATGA3’
microRNA-200c-3p 5’CTAATACTGCCGGGTAATGATGGA3’
U6 F: 5’GCTTCGGCAGCACATATACTAAAAT3’
R: 5’CGCTTCACGAATTTGCGTGTCAT3’
PTEN F: 5’TGGATTCGACTTAGACTTGACCT3’
R: 5’GGTGGGTTATGGTCTTCAAAAGG3’
ACTIN F: 5’TTCGAGCAAGAGATGGCCA3’
R: 5’CGTACAGGTCTTTGCGGAT3’